Rabbit anti-Human GP1BA, 0.4ml 

To Order Contact us: stephen@expresspharmapulse.com

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

RD-GP1Ba-Hu-48Tests 48 Tests
EUR 500

Human Glycoprotein Ib Alpha Polypeptide, Platelet (GP1Ba) ELISA Kit

RD-GP1Ba-Hu-96Tests 96 Tests
EUR 692

GP1BA Rabbit pAb

A16048-100ul 100 ul
EUR 308

GP1BA Rabbit pAb

A16048-200ul 200 ul
EUR 459

GP1BA Rabbit pAb

A16048-20ul 20 ul
EUR 183

GP1BA Rabbit pAb

A16048-50ul 50 ul
EUR 223

Anti-GP1BA antibody

STJ118501 100 µl
EUR 277

Rabbit Glycocalicin (GP1BA) ELISA Kit

abx355223-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

GP1BA antibody

70R-17553 50 ul
EUR 435
Description: Rabbit polyclonal GP1BA antibody

GP1BA Antibody

36512-100ul 100ul
EUR 252

GP1BA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

GP1BA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GP1BA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:100-1:300

GP1BA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GP1BA. Recognizes GP1BA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


ELA-E1710h 96 Tests
EUR 824


EF002776 96 Tests
EUR 689

Human GP1BA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GP1BA Recombinant Protein (Human)

RP013678 100 ug Ask for price

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

GP1BA Conjugated Antibody

C36512 100ul
EUR 397

GP1BA cloning plasmid

CSB-CL009685HU-10ug 10ug
EUR 636
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1881
  • Sequence: atgcctctcctcctcttgctgctcctgctgccaagccccttacacccccaccccatctgtgaggtctccaaagtggccagccacctagaagtgaactgtgacaagaggaatctgacagcgctgcctccagacctgccgaaagacacaaccatcctccacctgagtgagaacctcc
  • Show more
Description: A cloning plasmid for the GP1BA gene.

Human Glycocalicin (GP1BA) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Glycocalicin (GP1BA) ELISA Kit

abx570254-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

GP1BA ORF Vector (Human) (pORF)

ORF004560 1.0 ug DNA
EUR 95

GP1BA ELISA Kit (Human) (OKAN05260)

OKAN05260 96 Wells
EUR 792
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.3 pg/mL

GP1BA ELISA Kit (Human) (OKAN05261)

OKAN05261 96 Wells
EUR 792
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.35 ng/mL

GP1BA ELISA Kit (Human) (OKCD07149)

OKCD07149 96 Wells
EUR 936
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. GP1BA is the alpha subunit.Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Several polymorphisms and mutations have been described in this gene, some of which are the cause of Bernard-Soulier syndromes and platelet-type von Willebrand disease. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.35ng/mL

GP1BA ELISA Kit (Human) (OKCD07618)

OKCD07618 96 Wells
EUR 936
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. GP1BA is the alpha subunit.Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that are linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Several polymorphisms and mutations have been described in this gene, some of which are the cause of Bernard-Soulier syndromes and platelet-type von Willebrand disease. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 7.5pg/mL

GP1BA ELISA Kit (Human) (OKEH01226)

OKEH01226 96 Wells
EUR 662
Description: Description of target: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.6 pg/mL


ELI-05548d 96 Tests
EUR 928

Mouse GP1BA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16547 2 ug
EUR 325

GP1BA Recombinant Protein (Rat)

RP203150 100 ug Ask for price

GP1BA Recombinant Protein (Mouse)

RP139199 100 ug Ask for price

GP1BA sgRNA CRISPR Lentivector set (Human)

K0884601 3 x 1.0 ug
EUR 339

Rabbit Platelet Glycoprotein Ib Alpha Chain (GP1BA) ELISA Kit

abx362229-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Polyclonal GP1BA(Glycocalicin) Antibody (Center)

APR04673G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GP1BA(Glycocalicin) (Center). This antibody is tested and proven to work in the following applications:

Rabbit anti-Human GP1BA, 0.4ml