Human DBN1(Drebrin 1) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Hu-48Tests 48 Tests
EUR 544

Human Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Hu-96Tests 96 Tests
EUR 756

Human Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Hu-48Tests 48 Tests
EUR 521

Human Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Hu-96Tests 96 Tests
EUR 723

Mouse Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Mu-48T 48T
EUR 527
  • Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Mouse Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Mu-96T 96T
EUR 688
  • Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Rat Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Ra-48T 48T
EUR 549
  • Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Rat Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Ra-96T 96T
EUR 718
  • Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Mouse Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Mu-48Tests 48 Tests
EUR 557

Mouse Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Mu-96Tests 96 Tests
EUR 774

Rat Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Ra-48Tests 48 Tests
EUR 583

Rat Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Ra-96Tests 96 Tests
EUR 811

Mouse Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Mu-48Tests 48 Tests
EUR 533

Mouse Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Mu-96Tests 96 Tests
EUR 740

Rat Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Ra-48Tests 48 Tests
EUR 557

Rat Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Ra-96Tests 96 Tests
EUR 775

Human Drebrin 1 (DBN1) ELISA Kit

20-abx151349
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

4-SEC431Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Drebrin 1 elisa. Alternative names of the recognized antigen: Developmentally-regulated brain protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin 1 (DBN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Drebrin 1(DBN1)ELISA Kit

QY-E01394 96T
EUR 361

Human Drebrin, DBN1 ELISA KIT

ELI-09340h 96 Tests
EUR 824

Mouse Drebrin 1 (DBN1) ELISA Kit

abx576649-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.

Rat Drebrin 1 (DBN1) ELISA Kit

abx576683-96tests 96 tests
EUR 895
  • Shipped within 5-12 working days.

Drebrin 1 (DBN1) Antibody

20-abx112170
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Drebrin 1 (DBN1) Antibody

20-abx128413
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Drebrin 1 (DBN1) Antibody

20-abx172162
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Drebrin 1 (DBN1)

4-RPC431Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16643
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Drebrin 1 expressed in: E.coli

ELISA kit for Human DBN1 (Drebrin 1)

ELK3701 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin 1 (DBN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebrin 1 (DBN1).
  • Show more
Description: A sandwich ELISA kit for detection of Drebrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Drebrin 1 (DBN1) CLIA Kit

20-abx493691
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Drebrin 1 (DBN1) Protein

20-abx168078
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Drebrin, Dbn1 ELISA KIT

ELI-08819m 96 Tests
EUR 865

Chicken Drebrin, DBN1 ELISA KIT

ELI-48161c 96 Tests
EUR 928

Drebrin (DBN1) Antibody

20-abx004866
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dbn1 ELISA Kit| Rat Drebrin ELISA Kit

EF018604 96 Tests
EUR 689

Dbn1 ELISA Kit| Mouse Drebrin ELISA Kit

EF014734 96 Tests
EUR 689

DBN1 ELISA Kit| chicken Drebrin ELISA Kit

EF012286 96 Tests
EUR 689

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse)

4-PAC431Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1)

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), APC

4-PAC431Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with APC.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC431Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with Biotin.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC431Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with Cy3.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), FITC

4-PAC431Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with FITC.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), HRP

4-PAC431Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with HRP.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), PE

4-PAC431Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with PE.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC431Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Dbn1/ Rat Dbn1 ELISA Kit

ELI-32254r 96 Tests
EUR 886

DBN1 ELISA KIT|Human

EF004878 96 Tests
EUR 689

Anti-Drebrin Monoclonal Antibody (M2F6)

M05530-1 100ug
EUR 420
Description: Mouse Monoclonal Drebrin Antibody (M2F6). Validated in IP, IF, WB and tested in Mouse, Rat.

DBN1 ELISA Kit (Human) (OKCD00328)

OKCD00328 96 Wells
EUR 831
Description: Description of target: Drebrins might play some role in cell migration, extension of neuronal processes and plasticity of dendrites. Required for actin polymerization at immunological synapses (IS) and for CXCR4 recruitment to IS.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.16"F-actin-binding protein drebrin regulates CXCR4 recruitment to the immune synapse."_x005F_x005F_x000D_Perez-Martinez M., Gordon-Alonso M., Cabrero J.R., Barrero-Villar M., Rey M., Mittelbrunn M., Lamana A., Morlino G., Calabia C., Yamazaki H., Shirao T., Vazquez J., Gonzalez-Amaro R., Veiga E., Sanchez-Madrid F._x005F_x005F_x000D_J. Cell Sci. 123:1160-1170(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH CXCR4, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.047 ng/mL

DBN1 ELISA Kit (Human) (OKDD00224)

OKDD00224 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.047 ng/mL

DBN1 ELISA Kit (Mouse) (OKCA01658)

OKCA01658 96 Wells
EUR 846
Description: Description of target: Drebrins might play some role in cell migration, extension of neuronal processes and plasticity of dendrites. Required for actin polymerization at immunological synapses (IS) and for CXCR4 recruitment to IS.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 1.17 pg/mL

Human Drebrin- like protein, DBNL ELISA KIT

ELI-32386h 96 Tests
EUR 824

Human Drebrin Like Protein (DBNL) ELISA Kit

20-abx258176
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

4-SEL448Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Drebrin Like Protein elisa. Alternative names of the recognized antigen: ABP1
  • HIP-55
  • SH3P7
  • CMAP
  • Cervical mucin-associated protein
  • Drebrin-F
  • HPK1-interacting protein of 55 kDa
  • SH3 domain-containing protein 7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin Like Protein (DBNL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Drebrin Antibody

abx139395-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.

Drebrin Antibody

abx232535-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Drebrin Antibody

abx232536-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Drebrin antibody

10R-D117a 100 ug
EUR 570
Description: Mouse monoclonal Drebrin antibody

Drebrin antibody

10R-D117b 250 uL
EUR 483
Description: Mouse monoclonal Drebrin antibody

Drebrin antibody

20R-DP003 100 uL
EUR 510
Description: Guinea Pig polyclonal Drebrin antibody

Drebrin antibody

20R-DP004 100 uL
EUR 510
Description: Guinea Pig polyclonal Drebrin antibody

Drebrin antibody

10R-2460 5 mL
EUR 405
Description: Mouse monoclonal Drebrin antibody

Drebrin Antibody

DF12388 200ul
EUR 304
Description: Drebrin antibody detects endogenous levels of Drebrin.

DBN1 siRNA

20-abx901416
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DBN1 siRNA

20-abx913601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DBN1 siRNA

20-abx913602
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DBN1 antibody

38851-100ul 100ul
EUR 252

DBN1 antibody

70R-16748 50 ul
EUR 435
Description: Rabbit polyclonal DBN1 antibody

DBN1 Antibody

1-CSB-PA006524GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DBN1. Recognizes DBN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ELISA kit for Human DBNL (Drebrin Like Protein)

ELK7533 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin Like Protein (DBNL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebri
  • Show more
Description: A sandwich ELISA kit for detection of Drebrin Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human DBN1 shRNA Plasmid

20-abx951144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DBN1 Recombinant Protein (Human)

RP008782 100 ug Ask for price

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Drebrin- like protein, Dbnl ELISA KIT

ELI-26391m 96 Tests
EUR 865

Bovine Drebrin- like protein, DBNL ELISA KIT

ELI-09045b 96 Tests
EUR 928

Mouse Drebrin Like Protein (DBNL) ELISA Kit

abx389105-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Drebrin Like Protein (DBNL) ELISA Kit

abx391250-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

anti- Drebrin antibody

FNab02535 100µg
EUR 505.25
  • Immunogen: drebrin 1
  • Uniprot ID: Q16643
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin

anti- Drebrin antibody

FNab02536 100µg
EUR 585
  • Immunogen: drebrin 1
  • Uniprot ID: Q16643
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin

Drebrin Antibody (PE)

abx139396-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

Anti-Drebrin Purified

11-694-C025 0.025 mg
EUR 122

Anti-Drebrin Purified

11-694-C100 0.1 mg
EUR 204

Anti-Drebrin PE

1P-694-T025 25 tests
EUR 140

Anti-Drebrin PE

1P-694-T100 100 tests
EUR 240

Drebrin Blocking Peptide

DF12388-BP 1mg
EUR 195

Anti-Drebrin antibody

PAab02535 100 ug
EUR 355

Anti-Drebrin antibody

PAab02536 100 ug
EUR 412

Anti-Drebrin (2E11)

YF-MA12638 100 ug
EUR 363
Description: Mouse monoclonal to Drebrin

Dbnl ELISA Kit| Rat Drebrin-like protein ELISA Kit

EF018605 96 Tests
EUR 689

Dbnl ELISA Kit| Mouse Drebrin-like protein ELISA Kit

EF014735 96 Tests
EUR 689

DBNL ELISA Kit| Bovine Drebrin-like protein ELISA Kit

EF011332 96 Tests
EUR 689

DBN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0563202 1.0 ug DNA
EUR 154

Human Drebrin Like Protein (DBNL) CLIA Kit

20-abx495928
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

DBN1 Conjugated Antibody

C38851 100ul
EUR 397

DBN1 cloning plasmid

CSB-CL613692HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1950
  • Sequence: atggccggcgtcagcttcagcggccaccgcctggagctgctggcggcttacgaggaggtgatccgagaggagagcgcggccgactgggctctgtacacatatgaagatggctccgatgacctcaagcttgcagcatcaggagaagggggcttgcaggagctttcgggacactttg
  • Show more
Description: A cloning plasmid for the DBN1 gene.

DBN1 Rabbit pAb

A6366-100ul 100 ul
EUR 308

DBN1 Rabbit pAb

A6366-200ul 200 ul
EUR 459

DBN1 Rabbit pAb

A6366-20ul 20 ul
EUR 183

DBN1 Rabbit pAb

A6366-50ul 50 ul
EUR 223

Anti-DBN1 antibody

STJ28449 100 µl
EUR 277
Description: The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

DBN1 ORF Vector (Human) (pORF)

ORF002928 1.0 ug DNA
EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Drebrin recombinant monoclonal antibody

A5309 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Drebrin for WB,ELISA

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Mouse DBN1 shRNA Plasmid

20-abx974695
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DBN1 shRNA Plasmid

20-abx986627
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DBN1 Recombinant Protein (Rat)

RP197366 100 ug Ask for price

DBN1 Recombinant Protein (Mouse)

RP127913 100 ug Ask for price

DBN1 Recombinant Protein (Mouse)

RP127916 100 ug Ask for price

DBN1 Recombinant Protein (Mouse)

RP127919 100 ug Ask for price

Dbn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3747302 1.0 ug DNA
EUR 154

Human DBN1(Drebrin 1) ELISA Kit