Human DBN1(Drebrin 1) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Mouse Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Rat Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Rat Drebrin 1 (DBN1) ELISA Kit
DLR-DBN1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Mouse Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Drebrin 1 (DBN1) ELISA Kit
RDR-DBN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Mouse Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Drebrin 1 (DBN1) ELISA Kit
RD-DBN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Drebrin 1 (DBN1) ELISA Kit
20-abx151349	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit
SEC431Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit
4-SEC431Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Drebrin 1 elisa. Alternative names of the recognized antigen: Developmentally-regulated brain protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin 1 (DBN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Drebrin 1(DBN1)ELISA Kit
QY-E01394	Qayee Biotechnology	96T	EUR 361

Human Drebrin, DBN1 ELISA KIT
ELI-09340h	Lifescience Market	96 Tests	EUR 824

Mouse Drebrin 1 (DBN1) ELISA Kit
abx576649-96tests	Abbexa	96 tests	EUR 864
Shipped within 5-12 working days.

Rat Drebrin 1 (DBN1) ELISA Kit
abx576683-96tests	Abbexa	96 tests	EUR 895
Shipped within 5-12 working days.

Drebrin 1 (DBN1) Antibody
20-abx112170	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Drebrin 1 (DBN1) Antibody
20-abx128413	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Drebrin 1 (DBN1) Antibody
20-abx172162	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Drebrin 1 (DBN1)
4-RPC431Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16643 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Drebrin 1 expressed in: E.coli

ELISA kit for Human DBN1 (Drebrin 1)
ELK3701	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin 1 (DBN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebrin 1 (DBN1). Show more
Description: A sandwich ELISA kit for detection of Drebrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Drebrin 1 (DBN1) CLIA Kit
20-abx493691	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Drebrin 1 (DBN1) Protein
20-abx168078	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Drebrin, Dbn1 ELISA KIT
ELI-08819m	Lifescience Market	96 Tests	EUR 865

Chicken Drebrin, DBN1 ELISA KIT
ELI-48161c	Lifescience Market	96 Tests	EUR 928

Drebrin (DBN1) Antibody
20-abx004866	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Dbn1 ELISA Kit| Rat Drebrin ELISA Kit
EF018604	Lifescience Market	96 Tests	EUR 689

Dbn1 ELISA Kit| Mouse Drebrin ELISA Kit
EF014734	Lifescience Market	96 Tests	EUR 689

DBN1 ELISA Kit| chicken Drebrin ELISA Kit
EF012286	Lifescience Market	96 Tests	EUR 689

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse)
4-PAC431Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1)

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), APC
4-PAC431Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with APC.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC431Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with Biotin.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC431Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with Cy3.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), FITC
4-PAC431Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with FITC.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), HRP
4-PAC431Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with HRP.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), PE
4-PAC431Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with PE.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC431Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBN1 (Gly3~Ser134 ) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Dbn1/ Rat Dbn1 ELISA Kit
ELI-32254r	Lifescience Market	96 Tests	EUR 886

DBN1 ELISA KIT|Human
EF004878	Lifescience Market	96 Tests	EUR 689

Anti-Drebrin Monoclonal Antibody (M2F6)
M05530-1	BosterBio	100ug	EUR 420
Description: Mouse Monoclonal Drebrin Antibody (M2F6). Validated in IP, IF, WB and tested in Mouse, Rat.

DBN1 ELISA Kit (Human) (OKCD00328)
OKCD00328	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Drebrins might play some role in cell migration, extension of neuronal processes and plasticity of dendrites. Required for actin polymerization at immunological synapses (IS) and for CXCR4 recruitment to IS.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.16"F-actin-binding protein drebrin regulates CXCR4 recruitment to the immune synapse."_x005F_x005F_x000D_Perez-Martinez M., Gordon-Alonso M., Cabrero J.R., Barrero-Villar M., Rey M., Mittelbrunn M., Lamana A., Morlino G., Calabia C., Yamazaki H., Shirao T., Vazquez J., Gonzalez-Amaro R., Veiga E., Sanchez-Madrid F._x005F_x005F_x000D_J. Cell Sci. 123:1160-1170(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH CXCR4, SUBCELLULAR LOCATION, TISSUE SPECIFICITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.047 ng/mL

DBN1 ELISA Kit (Human) (OKDD00224)
OKDD00224	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.047 ng/mL

DBN1 ELISA Kit (Mouse) (OKCA01658)
OKCA01658	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Drebrins might play some role in cell migration, extension of neuronal processes and plasticity of dendrites. Required for actin polymerization at immunological synapses (IS) and for CXCR4 recruitment to IS.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 1.17 pg/mL

Human Drebrin- like protein, DBNL ELISA KIT
ELI-32386h	Lifescience Market	96 Tests	EUR 824

Human Drebrin Like Protein (DBNL) ELISA Kit
20-abx258176	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Drebrin Like Protein (DBNL) ELISA Kit
SEL448Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit
SEL448Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit
SEL448Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit
SEL448Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit
4-SEL448Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Drebrin Like Protein elisa. Alternative names of the recognized antigen: ABP1 HIP-55 SH3P7 CMAP Cervical mucin-associated protein Drebrin-F HPK1-interacting protein of 55 kDa SH3 domain-containing protein 7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin Like Protein (DBNL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Drebrin Antibody
abx139395-01mg	Abbexa	0.1 mg	EUR 425
Shipped within 5-12 working days.

Drebrin Antibody
abx232535-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Drebrin Antibody
abx232536-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Drebrin antibody
10R-D117a	Fitzgerald	100 ug	EUR 570
Description: Mouse monoclonal Drebrin antibody

Drebrin antibody
10R-D117b	Fitzgerald	250 uL	EUR 483
Description: Mouse monoclonal Drebrin antibody

Drebrin antibody
20R-DP003	Fitzgerald	100 uL	EUR 510
Description: Guinea Pig polyclonal Drebrin antibody

Drebrin antibody
20R-DP004	Fitzgerald	100 uL	EUR 510
Description: Guinea Pig polyclonal Drebrin antibody

Drebrin antibody
10R-2460	Fitzgerald	5 mL	EUR 405
Description: Mouse monoclonal Drebrin antibody

Drebrin Antibody
DF12388	Affbiotech	200ul	EUR 304
Description: Drebrin antibody detects endogenous levels of Drebrin.

DBN1 siRNA
20-abx901416	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DBN1 siRNA
20-abx913601	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DBN1 siRNA
20-abx913602	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DBN1 antibody
38851-100ul	SAB	100ul	EUR 252

DBN1 antibody
70R-16748	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DBN1 antibody

DBN1 Antibody
1-CSB-PA006524GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DBN1. Recognizes DBN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ELISA kit for Human DBNL (Drebrin Like Protein)
ELK7533	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin Like Protein (DBNL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebri Show more
Description: A sandwich ELISA kit for detection of Drebrin Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human DBN1 shRNA Plasmid
20-abx951144	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DBN1 Recombinant Protein (Human)
RP008782	ABM	100 ug	Ask for price

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Mouse Drebrin- like protein, Dbnl ELISA KIT
ELI-26391m	Lifescience Market	96 Tests	EUR 865

Bovine Drebrin- like protein, DBNL ELISA KIT
ELI-09045b	Lifescience Market	96 Tests	EUR 928

Mouse Drebrin Like Protein (DBNL) ELISA Kit
abx389105-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Drebrin Like Protein (DBNL) ELISA Kit
abx391250-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

anti- Drebrin antibody
FNab02535	FN Test	100µg	EUR 505.25
Immunogen: drebrin 1 Uniprot ID: Q16643 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin

anti- Drebrin antibody
FNab02536	FN Test	100µg	EUR 585
Immunogen: drebrin 1 Uniprot ID: Q16643 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin

Drebrin Antibody (PE)
abx139396-100tests	Abbexa	100 tests	EUR 481
Shipped within 5-12 working days.

Anti-Drebrin Purified
11-694-C025	ExBio	0.025 mg	EUR 122

Anti-Drebrin Purified
11-694-C100	ExBio	0.1 mg	EUR 204

Anti-Drebrin PE
1P-694-T025	ExBio	25 tests	EUR 140

Anti-Drebrin PE
1P-694-T100	ExBio	100 tests	EUR 240

Drebrin Blocking Peptide
DF12388-BP	Affbiotech	1mg	EUR 195

Anti-Drebrin antibody
PAab02535	Lifescience Market	100 ug	EUR 355

Anti-Drebrin antibody
PAab02536	Lifescience Market	100 ug	EUR 412

Anti-Drebrin (2E11)
YF-MA12638	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Drebrin

Dbnl ELISA Kit| Rat Drebrin-like protein ELISA Kit
EF018605	Lifescience Market	96 Tests	EUR 689

Dbnl ELISA Kit| Mouse Drebrin-like protein ELISA Kit
EF014735	Lifescience Market	96 Tests	EUR 689

DBNL ELISA Kit| Bovine Drebrin-like protein ELISA Kit
EF011332	Lifescience Market	96 Tests	EUR 689

DBN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0563202	ABM	1.0 ug DNA	EUR 154

Human Drebrin Like Protein (DBNL) CLIA Kit
20-abx495928	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

DBN1 Conjugated Antibody
C38851	SAB	100ul	EUR 397

DBN1 cloning plasmid
CSB-CL613692HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1950 Sequence: atggccggcgtcagcttcagcggccaccgcctggagctgctggcggcttacgaggaggtgatccgagaggagagcgcggccgactgggctctgtacacatatgaagatggctccgatgacctcaagcttgcagcatcaggagaagggggcttgcaggagctttcgggacactttg Show more
Description: A cloning plasmid for the DBN1 gene.

DBN1 Rabbit pAb
A6366-100ul	Abclonal	100 ul	EUR 308

DBN1 Rabbit pAb
A6366-200ul	Abclonal	200 ul	EUR 459

DBN1 Rabbit pAb
A6366-20ul	Abclonal	20 ul	EUR 183

DBN1 Rabbit pAb
A6366-50ul	Abclonal	50 ul	EUR 223

Anti-DBN1 antibody
STJ28449	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

DBN1 ORF Vector (Human) (pORF)
ORF002928	ABM	1.0 ug DNA	EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Drebrin recombinant monoclonal antibody
A5309	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human Drebrin for WB,ELISA

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Mouse DBN1 shRNA Plasmid
20-abx974695	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat DBN1 shRNA Plasmid
20-abx986627	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DBN1 Recombinant Protein (Rat)
RP197366	ABM	100 ug	Ask for price

DBN1 Recombinant Protein (Mouse)
RP127913	ABM	100 ug	Ask for price

DBN1 Recombinant Protein (Mouse)
RP127916	ABM	100 ug	Ask for price

DBN1 Recombinant Protein (Mouse)
RP127919	ABM	100 ug	Ask for price

Dbn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3747302	ABM	1.0 ug DNA	EUR 154

Human DBN1(Drebrin 1) ELISA Kit