Bovine HMGB1 

To Order Contact us: stephen@expresspharmapulse.com

Anti-Bovine HMGB1 IgY Antibodies

7064 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 IgY Antibodies

Anti-Bovine HMGB1 Antibody, Clone 1-37.10FH

7047 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 Antibody

Anti-Bovine HMGB1 Antibody, Clone 1-37.10FH, Biotinylated

70471 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 Antibody

HMGB1 Antibody

AF7020 200ul
EUR 376
Description: HMGB1 antibody detects endogenous levels of total HMGB1.

HMGB1 Protein

20-abx600027
  • EUR 1887.00
  • EUR 1261.00
  • EUR 1372.00
  • EUR 968.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 months.

HMGB1 siRNA

20-abx902481
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 antibody

ABF7020 100 ug
EUR 438

HMGB1 Protein

20-abx260452
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HMGB1 siRNA

20-abx919601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 siRNA

20-abx919602
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 Antibody

A1005-50
EUR 452

HMGB1 antibody

70R-31573 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

ABD3077 100 ug
EUR 438

HMGB1 Antibody

ABD7008 100 ug
EUR 438

HMGB1 antibody

38424-100ul 100ul
EUR 252

HMGB1 Antibody

33661-100ul 100ul
EUR 252

HMGB1 Antibody

33661-50ul 50ul
EUR 187

HMGB1 Antibody

48606-100ul 100ul
EUR 333

HMGB1 Antibody

48606-50ul 50ul
EUR 239

HMGB1 antibody

10R-1114 100 ul
EUR 349
Description: Mouse monoclonal HMGB1 antibody

HMGB1 protein

30R-1150 100 ug
EUR 457
Description: Purified recombinant Human HMGB1 protein

HMGB1 antibody

70R-17757 50 ul
EUR 435
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-15458 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

DF7008 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

1-CSB-PA995991
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

HMGB1 Antibody

DF3077 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

1-CSB-PA005927
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HMGB1 Antibody

1-CSB-PA002937
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HMGB1 Antibody

1-CSB-PA010553GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HMGB1 Antibody

1-CSB-PA010553YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMGB1 Antibody

1-CSB-PA225274
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

HMGB1 Antibody

CSB-PA049959-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

CSB-PA049959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

1-CSB-PA01604A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HMGB1 Plasmid

PVT7114 2 ug
EUR 266

pENTR223- HMGB1

PVT10093 2 ug
EUR 266

anti-HMGB1

YF-PA12378 100 ul
EUR 403
Description: Rabbit polyclonal to HMGB1

anti-HMGB1

YF-PA23886 50 ul
EUR 334
Description: Mouse polyclonal to HMGB1

HMGB1, human

RC712-17 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Other

HMGB1 Blocking Peptide

AF7020-BP 1mg
EUR 195

HMGB1 Conjugated Antibody

C48606 100ul
EUR 397

HMGB1 Conjugated Antibody

C33661 100ul
EUR 397

HMGB1 cloning plasmid

CSB-CL010553HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 cloning plasmid

CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1/HMG-1

E21-357 10ug
EUR 343

anti- HMGB1 antibody

FNab10218 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: High mobility group protein B1
  • Uniprot ID: P09429
  • Gene ID: 3146
Description: Antibody raised against HMGB1

anti- HMGB1 antibody

FNab03924 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: high-mobility group box 1
  • Uniprot ID: P09429
  • Gene ID: 3146
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HMGB1

HMGB1 (AcK12) Antibody

20-abx141151
  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

20-abx061647
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

20-abx061850
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-HMGB1 Antibody

A00066-1 100ug/vial
EUR 334

HMGB1 Polyclonal Antibody

A-2700 100 µl
EUR 724.25
Description: The best epigenetics products

HMGB1 Rabbit pAb

A0718-100ul 100 ul
EUR 308

HMGB1 Rabbit pAb

A0718-200ul 200 ul
EUR 459

HMGB1 Rabbit pAb

A0718-20ul 20 ul Ask for price

HMGB1 Rabbit pAb

A0718-50ul 50 ul Ask for price

HMGB1 Polyclonal Antibody

A51497 100 µg
EUR 570.55
Description: kits suitable for this type of research

HMGB1 protein (Mouse)

30R-2278 100 ug
EUR 2012
Description: Purified recombinant Mouse HMGB1 protein

HMGB1 antibody (HRP)

60R-2188 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (HRP)

HMGB1 antibody (FITC)

60R-2189 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (FITC)

HMGB1 antibody (biotin)

60R-2190 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (biotin)

HMGB1 Detection Kit

6010 1 kit
EUR 753.25
Description: HMGB1 Detection Kit

HMGB1 Blocking Peptide

DF7008-BP 1mg
EUR 195

HMGB1 ELISA Kit

DEIA6297V2 96T
EUR 876
Description: CD provides a capture ELISA kit to determine HMGB1 levels in cell culture medium and sera. This kit contains enough reagents to measure 40 samples in duplicate together with standards.

HMGB1 Blocking Peptide

DF3077-BP 1mg
EUR 195

Anti-HMGB1 antibody

PAab03924 100 ug
EUR 355

Bovine HMGB1