CISH Polymer detection kit 

To Order Contact us: stephen@expresspharmapulse.com

Cish/ Rat Cish ELISA Kit

ELI-10207r 96 Tests
EUR 886

Dihydroxydimethyldiphenylmethanedisulphonic acid polymer

TBW00037 unit Ask for price

Cish antibody

70R-14323 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal Cish antibody

CISH antibody

38795-100ul 100ul
EUR 252

CISH Antibody

43887-100ul 100ul
EUR 252

CISH Antibody

1-CSB-PA885721ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CISH. Recognizes CISH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CISH Antibody

DF8914 200ul
EUR 304
Description: CISH Antibody detects endogenous levels of total CISH.

Cish antibody

70R-9203 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Cish antibody

CISH siRNA

20-abx911889
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CISH siRNA

20-abx911890
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CISH Antibody

ABD8914 100 ug
EUR 438

anti-CISH

YF-PA10961 50 ug
EUR 363
Description: Mouse polyclonal to CISH

anti-CISH

YF-PA10962 100 ug
EUR 403
Description: Rabbit polyclonal to CISH

Chicken CISH ELISA KIT

ELI-10206c 96 Tests
EUR 928

Human CISH ELISA KIT

ELI-46799h 96 Tests
EUR 824

Bovine CISH ELISA KIT

ELI-50096b 96 Tests
EUR 928

Mouse Cish ELISA KIT

ELI-50097m 96 Tests
EUR 865

CISH Rabbit pAb

A14527-100ul 100 ul
EUR 308

CISH Rabbit pAb

A14527-200ul 200 ul
EUR 459

CISH Rabbit pAb

A14527-20ul 20 ul
EUR 183

CISH Rabbit pAb

A14527-50ul 50 ul
EUR 223

Cish Blocking Peptide

33R-7890 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Cish antibody, catalog no. 70R-9203

CISH Blocking Peptide

DF8914-BP 1mg
EUR 195

Polyclonal CISH Antibody

APR15453G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CISH . This antibody is tested and proven to work in the following applications:

CISH Conjugated Antibody

C43887 100ul
EUR 397

CISH Conjugated Antibody

C38795 100ul
EUR 397

CISH cloning plasmid

CSB-CL885721HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 777
  • Sequence: atggtcctctgcgttcagggacctcgtcctttgctggctgtggagcggactgggcagcggcccctgtgggccccgtccctggaactgcccaagccagtcatgcagcccttgcctgctggggccttcctcgaggaggtggcagagggtaccccagcccagacagagagtgagccaaa
  • Show more
Description: A cloning plasmid for the CISH gene.

CISH Rabbit pAb

A6286-100ul 100 ul
EUR 308

CISH Rabbit pAb

A6286-200ul 200 ul
EUR 459

CISH Rabbit pAb

A6286-20ul 20 ul
EUR 183

CISH Rabbit pAb

A6286-50ul 50 ul
EUR 223

Anti-CISH Antibody

PA1786 100ug/vial
EUR 334

Anti-CISH antibody

STJ28208 100 µl
EUR 277
Description: The protein encoded by this gene contains a SH2 domain and a SOCS box domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by IL2, IL3, GM-CSF and EPO in hematopoietic cells. Proteasome-mediated degradation of this protein has been shown to be involved in the inactivation of the erythropoietin receptor. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CISH antibody

STJ116738 100 µl
EUR 277
Description: The protein encoded by this gene contains a SH2 domain and a SOCS box domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by IL2, IL3, GM-CSF and EPO in hematopoietic cells. Proteasome-mediated degradation of this protein has been shown to be involved in the inactivation of the erythropoietin receptor. Multiple transcript variants encoding different isoforms have been found for this gene.

CRF Anti-Polyvalent HRP Polymer

ABZ008 8 ml
EUR 133

CRF Anti-Polyvalent HRP Polymer

ABZ015 15 ml
EUR 197

CRF Anti-Polyvalent HRP Polymer

ABZ125 125 ml
EUR 681

CRF Anti-Polyvalent HRP Polymer

ABZ500 500 ml
EUR 2487

CRF Anti-Polyvalent HRP Polymer

ABZ999 1000 ml
EUR 4756

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

HMGB1 Detection Kit

6010 1 kit
EUR 753.25
Description: HMGB1 Detection Kit

SEB Detection Kit

6030 1 kit
EUR 553.15
Description: SEB Detection Kit

Senescence Detection Kit

55R-1370 250 tests
EUR 712
Description: Senescence Detection Kit for use in the research laboratory

Apoptosis Detection Kit

ANXVKB-100T 100 test
EUR 464.7

Apoptosis Detection Kit

ANXVKCFB-100T 100 test
EUR 412.7

Apoptosis Detection Kit

ANXVKCFB7-100T 100 test
EUR 412.7

Apoptosis Detection Kit

ANXVKDY-100T 100 test
EUR 389.3

Apoptosis Detection Kit

ANXVKF-100T 100 test
EUR 329.5

Apoptosis Detection Kit

ANXVKF7-100T 100 test
EUR 329.5

CISH Polymer detection kit