NOV Antibody 

To Order Contact us: stephen@expresspharmapulse.com

NOV antibody
70R-NR012	Fitzgerald	50 ug	EUR 273
Description: Affinity purified Rabbit polyclonal NOV antibody

NOV Antibody
36547-100ul	SAB	100ul	EUR 252

NOV antibody
70R-1714	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal NOV antibody raised against the middle region of NOV

NOV antibody
70R-1715	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal NOV antibody raised against the C terminal of NOV

NOV Antibody
1-CSB-PA987170	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOV. Recognizes NOV from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

NOV Antibody
1-CSB-PA005674	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NOV. Recognizes NOV from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NOV Antibody
1-CSB-PA015956ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NOV. Recognizes NOV from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NOV Conjugated Antibody
C36547	SAB	100ul	EUR 397

Nov Polyclonal Antibody
ES4142-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nov from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Nov Polyclonal Antibody
ES4142-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nov from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- NOV antibody
FNab05801	FN Test	100µg	EUR 505.25
Immunogen: nephroblastoma overexpressed gene Uniprot ID: P48745 Gene ID: 4856 Research Area: Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against NOV

Nov Polyclonal Antibody
ABP53143-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Nov Applications tips:
Description: A polyclonal antibody for detection of Nov from Human, Mouse. This Nov antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nov

Nov Polyclonal Antibody
ABP53143-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Nov Applications tips:
Description: A polyclonal antibody for detection of Nov from Human, Mouse. This Nov antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nov

Nov Polyclonal Antibody
ABP53143-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Nov Applications tips:
Description: A polyclonal antibody for detection of Nov from Human, Mouse. This Nov antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nov

Norovirus (NOV) Antibody
abx022119-1mg	Abbexa	1 mg	EUR 940
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx022120-1mg	Abbexa	1 mg	EUR 940
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx023841-1mg	Abbexa	1 mg	EUR 843
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx023842-1mg	Abbexa	1 mg	EUR 843
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx023843-1mg	Abbexa	1 mg	EUR 843
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx023844-1mg	Abbexa	1 mg	EUR 843
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx023845-1mg	Abbexa	1 mg	EUR 843
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx023846-1mg	Abbexa	1 mg	EUR 843
Shipped within 5-10 working days.

Norovirus (NOV) Antibody
abx023847-1mg	Abbexa	1 mg	EUR 843
Shipped within 5-10 working days.

Nov Polyclonal Antibody
41797-100ul	SAB	100ul	EUR 252

Nov Polyclonal Antibody
41797-50ul	SAB	50ul	EUR 187

Anti-NOV antibody
PAab05801	Lifescience Market	100 ug	EUR 355

Anti-Nov antibody
STJ96777	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Nov.

Anti-NOV antibody
STJ27273	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development.

Anti-NOV antibody
STJ116698	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development.

Nov/ Rat Nov ELISA Kit
ELI-35315r	Lifescience Market	96 Tests	EUR 886

Chicken Protein NOV, NOV ELISA KIT
ELI-38132c	Lifescience Market	96 Tests	EUR 928

Mouse Protein NOV Homolog (NOV) Protein
20-abx261807	Abbexa	EUR 4365.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Human Protein NOV Homolog (NOV) Protein
20-abx261834	Abbexa	EUR 4379.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

NOV siRNA
20-abx903608	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOV siRNA
20-abx926185	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOV siRNA
20-abx926186	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOV protein
30R-AN038	Fitzgerald	20 ug	EUR 273
Description: Purified recombinant Human NOV protein

Anti-NOV/CCN3 Antibody
A06319-1	BosterBio	100ug/vial	EUR 334

Mouse Protein NOV homolog, Nov ELISA KIT
ELI-14991m	Lifescience Market	96 Tests	EUR 865

Human Protein NOV homolog, NOV ELISA KIT
ELI-35314h	Lifescience Market	96 Tests	EUR 824

Human Protein NOV homolog(NOV) ELISA kit
CSB-EL015956HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Protein NOV homolog (NOV) in samples from serum, plasma, tissue homogenates . A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein NOV homolog(NOV) ELISA kit
1-CSB-EL015956HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Protein NOV homolog(NOV) in samples from serum, plasma, tissue homogenates . Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein NOV homolog(NOV) ELISA kit
CSB-EL015956MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein NOV homolog (NOV) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein NOV homolog(NOV) ELISA kit
1-CSB-EL015956MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein NOV homolog(NOV) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Protein NOV homolog(NOV) ELISA kit
CSB-EL015956RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein NOV homolog (NOV) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Protein NOV homolog(NOV) ELISA kit
1-CSB-EL015956RA	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein NOV homolog(NOV) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

NOV cloning plasmid
CSB-CL015956HU-10ug	Cusabio	10ug	EUR 411
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1074 Sequence: atgcagagtgtgcagagcacgagcttttgtctccgaaagcagtgcctttgcctgaccttcctgcttctccatctcctgggacaggtcgctgcgactcagcgctgccctccccagtgcccgggccggtgccctgcgacgccgccgacctgcgcccccggggtgcgcgcggtgctgg Show more
Description: A cloning plasmid for the NOV gene.

NOV Rabbit pAb
A5320-100ul	Abclonal	100 ul	EUR 308

NOV Rabbit pAb
A5320-200ul	Abclonal	200 ul	EUR 459

NOV Rabbit pAb
A5320-20ul	Abclonal	20 ul	EUR 183

NOV Rabbit pAb
A5320-50ul	Abclonal	50 ul	EUR 223

NOV Rabbit pAb
A14488-100ul	Abclonal	100 ul	EUR 308

NOV Rabbit pAb
A14488-200ul	Abclonal	200 ul	EUR 459

NOV Rabbit pAb
A14488-20ul	Abclonal	20 ul	EUR 183

NOV Rabbit pAb
A14488-50ul	Abclonal	50 ul	EUR 223

NOV Blocking Peptide
33R-4680	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOV antibody, catalog no. 70R-1715

NOV Blocking Peptide
33R-8084	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOV antibody, catalog no. 70R-1714

pCMV-SPORT6-NOV
PVT13271	Lifescience Market	2 ug	EUR 391

Nephroblastoma Overexpressed Gene (NOV) Antibody
20-abx129784	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nephroblastoma Overexpressed Gene (NOV) Antibody
20-abx130360	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nephroblastoma Overexpressed Gene (NOV) Antibody
20-abx130794	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nephroblastoma Overexpressed Gene (NOV) Antibody
abx235801-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Polyclonal CCN3 / NOV Antibody (C-Terminus)
APR02446G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCN3 / NOV (C-Terminus). This antibody is tested and proven to work in the following applications:

Rat NOV shRNA Plasmid
20-abx986601	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NOV ELISA KIT|Human
EF001289	Lifescience Market	96 Tests	EUR 689

Human NOV shRNA Plasmid
20-abx953228	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NOV shRNA Plasmid
20-abx971787	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Human NOV Protein
PROTP48745-2	BosterBio	20ug	EUR 317
Description: NOV is a member of the CCN family of secreted cysteine rich regulatory proteins. The full length NOV protein contains four structural domains that confer distinct, and sometimes opposing, biological activities. Elevated expression of NOV is associated with certain tumors, including Wilm’s tumor and most nephroblastomas. However, in other tumor types and certain cancer cell lines, increased tumorgenicity and proliferation is correlated with decreased NOV expression. Additionally, NOV induces cell adhesion and cell migration by signaling through specific cell surface integrins and by binding to heparin sulfate proteoglycans and to fibulin 1C. NOV has also been reported to exert proangiogenic activities. Recombinant human NOV is a 36.2 kDa protein containing 331 amino acid residues. It is composed of four distinct structural domains (modules); the IGF binding protein (IGFBP) domain, the von Willebrand Factor C (VWFC) domain, the Thrombospondin type-I (TSP type-1) domain, and a C-terminal cysteine knot-like domain (CTCK).

Recombinant NoV VP1 Protein
VAng-Wyb3670-50g	Creative Biolabs	50 µg	EUR 1411
Description: Norovirus VP1, recombinant protein.

Monoclonal NOV Antibody (monoclonal) (M01), Clone: 3C2
AMM03865G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NOV (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3C2. This antibody is applicable in WB, E

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human)
4-PAG309Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV)

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse)
4-PAG309Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV)

Mouse Norovirus (NoV) ELISA Kit
abx055035-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Norovirus (NoV) ELISA Kit
abx055762-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

NOV ORF Vector (Human) (pORF)
ORF007166	ABM	1.0 ug DNA	EUR 95

Human CellExp? NOV, human recombinant
P1022-10	Biovision		EUR 196

Human CellExp? NOV, human recombinant
P1022-25	Biovision		EUR 294

Human NOV/CCN3 ELISA Kit
LF-EK50926	Abfrontier	1×96T	EUR 648

Nov ORF Vector (Rat) (pORF)
ORF071423	ABM	1.0 ug DNA	EUR 506

Nov ORF Vector (Mouse) (pORF)
ORF051542	ABM	1.0 ug DNA	EUR 506

Recombinant Nephroblastoma Overexpressed Gene (NOV)
4-RPG309Hu01	Cloud-Clone	EUR 460.19 EUR 226.00 EUR 1450.72 EUR 550.24 EUR 1000.48 EUR 371.00 EUR 3476.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P48745 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 54.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Nephroblastoma Overexpressed Gene expressed in: E.coli

Recombinant Nephroblastoma Overexpressed Gene (NOV)
4-RPG309Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q64299 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.5kDa Isoelectric Point: 8.4
Description: Recombinant Mouse Nephroblastoma Overexpressed Gene expressed in: E.coli

Recombinant Nephroblastoma Overexpressed Gene (NOV)
4-RPG309Ra01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QZQ5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 25.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat Nephroblastoma Overexpressed Gene expressed in: E.coli

Recombinant human NOV/CCN3 Protein
RP01186	Abclonal	10 μg	EUR 183

NOV ELISA Kit (Human) (OKBB00827)
OKBB00827	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: NOV(nephroblastoma overexpressed), also known as CCN3, is a matricellular protein that in humans is encoded by the NOV gene. The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. This gene is mapped to 8q24.12. NOV is a potentially useful marker for the diagnosis of adrenal gland diseases, malignant adrenocortical tumors, multiple sclerosis and so on. Moreover, reduced expression of NOV in ACTs may play an important role in the process of childhood ACT tumorigenesis. Though studying, it identified Nov as a regulator of human hematopoietic stem or progenitor cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <2pg/ml

NOV ELISA Kit (Mouse) (OKBB00828)
OKBB00828	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: NOV (nephroblastoma overexpressed), also known as CCN3, is a matricellular protein that in humans is encoded by the NOV gene. The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. This gene is mapped to 8q24.12. NOV is a potentially useful marker for the diagnosis of adrenal gland diseases, malignant adrenocortical tumors, multiple sclerosis and so on. Moreover, reduced expression of NOV in ACTs may play an important role in the process of childhood ACT tumorigenesis. Though studying, it identified Nov as a regulator of human hematopoietic stem or progenitor cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

NOV ELISA Kit (Rat) (OKCA00996)
OKCA00996	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Immediate-early protein playing a role in various cellular processes including proliferation, adhesion, migration, differentiation and survival. Acts by binding to integrins or membrane receptors such as NOTCH1. Essential regulator of hematopoietic stem and progenitor cell function. Inhibits myogenic differentiation through the activation of Notch-signaling pathway. Inhibits vascular smooth muscle cells proliferation by increasing expression of cell-cycle regulators such as CDKN2B or CDKN1A independently of TGFB1 signaling. Ligand of integrins ITGAV:ITGB3 and ITGA5:ITGB1, acts directly upon endothelial cells to stimulate pro-angiogenic activities and induces angiogenesis. In endothelial cells, supports cell adhesion, induces directed cell migration (chemotaxis) and promotes cell survival. Plays also a role in cutaneous wound healing acting as integrin receptor ligand. Supports skin fibroblast adhesion through ITGA5:ITGB1 and ITGA6:ITGB1 and induces fibroblast chemotaxis through ITGAV:ITGB5. Seems to enhance bFGF-induced DNA synthesis in fibroblasts. Involved in bone regeneration as a negative regulator. Enhances the articular chondrocytic phenotype, whereas it repressed the one representing endochondral ossification . Impairs pancreatic beta-cell function, inhibits beta-cell proliferation and insulin secretion. Plays a role as negative regulator of endothelial pro-inflammatory activation reducing monocyte adhesion, its anti-inflammatory effects occur secondary to the inhibition of NF-kappaB signaling pathway. Contributes to the control and coordination of inflammatory processes in atherosclerosis. Attenuates inflammatory pain through regulation of IL1B- and TNF-induced MMP9, MMP2 and CCL2 expression. Inhibits MMP9 expression through ITGB1 engagement .;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 ng/mL

NOV ELISA Kit (Mouse) (OKCA01755)
OKCA01755	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Immediate-early protein playing a role in various cellular processes including proliferation, adhesion, migration, differentiation and survival. Acts by binding to integrins or membrane receptors such as NOTCH1. Essential regulator of hematopoietic stem and progenitor cell function. Inhibits myogenic differentiation through the activation of Notch-signaling pathway. Inhibits vascular smooth muscle cells proliferation by increasing expression of cell-cycle regulators such as CDKN2B or CDKN1A independently of TGFB1 signaling. Ligand of integrins ITGAV:ITGB3 and ITGA5:ITGB1, acts directly upon endothelial cells to stimulate pro-angiogenic activities and induces angiogenesis. In endothelial cells, supports cell adhesion, induces directed cell migration (chemotaxis) and promotes cell survival. Plays also a role in cutaneous wound healing acting as integrin receptor ligand. Supports skin fibroblast adhesion through ITGA5:ITGB1 and ITGA6:ITGB1 and induces fibroblast chemotaxis through ITGAV:ITGB5. Seems to enhance bFGF-induced DNA synthesis in fibroblasts. Involved in bone regeneration as a negative regulator (PubMed:23653360). Enhances the articular chondrocytic phenotype, whereas it repressed the one representing endochondral ossification. Impairs pancreatic beta-cell function, inhibits beta-cell proliferation and insulin secretion (PubMed:23705021). Plays a role as negative regulator of endothelial pro-inflammatory activation reducing monocyte adhesion, its anti-inflammatory effects occur secondary to the inhibition of NF-kappaB signaling pathway. Contributes to the control and coordination of inflammatory processes in atherosclerosis (PubMed:24722330). Attenuates inflammatory pain through regulation of IL1B- and TNF-induced MMP9, MMP2 and CCL2 expression. Inhibits MMP9 expression through ITGB1 engagement.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.85 pg/mL

Monoclonal CCN3 / NOV Antibody (clone 2G8), Clone: 2G8
AMM02123G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human CCN3 / NOV (clone 2G8). The antibodies are raised in Mouse and are from clone 2G8. This antibody is applicable in WB and IHC-P, E, IP

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), APC
4-PAG309Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), Biotinylated
4-PAG309Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Biotin.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), Cy3
4-PAG309Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Cy3.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), FITC
4-PAG309Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with FITC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), HRP
4-PAG309Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with HRP.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), PE
4-PAG309Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with PE.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), APC
4-PAG309Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), Biotinylated
4-PAG309Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Biotin.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), Cy3
4-PAG309Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Cy3.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), FITC
4-PAG309Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with FITC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), HRP
4-PAG309Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with HRP.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), PE
4-PAG309Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with PE.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat)
4-PAG309Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Ala156~Met351) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV)

Human Nephroblastoma Overexpressed Gene (NOV) Protein
20-abx650684	Abbexa	EUR 648.00 EUR 272.00 EUR 1957.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Human NOV/CCN3
EK5373	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NOV/CCN3 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse NOV/CCN3
EK5374	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NOV/CCN3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NOV/CCN3 PicoKine ELISA Kit
EK0833	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human NOV in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse NOV/CCN3 PicoKine ELISA Kit
EK0834	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse NOV in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human NOV(Nephroblastoma overexpressed)ELISA Kit
EH10616	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Rat Nephroblastoma Overexpressed Gene (NOV) Protein
20-abx167777	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Nephroblastoma Overexpressed Gene (NOV) Protein
20-abx167274	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

NOV sgRNA CRISPR Lentivector set (Human)
K1442701	ABM	3 x 1.0 ug	EUR 339

Nov sgRNA CRISPR Lentivector set (Mouse)
K3425701	ABM	3 x 1.0 ug	EUR 339

Nov sgRNA CRISPR Lentivector set (Rat)
K7089501	ABM	3 x 1.0 ug	EUR 339

NOV Nephroblastoma Overexpressed Human Recombinant Protein
PROTP48745	BosterBio	Regular: 20ug	EUR 317
Description: Nephroblastoma Overexpressed Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 331 amino acids and having a molecular mass of 36.2 kDa. The NOV is purified by proprietary chromatographic techniques.

NOV Nephroblastoma Overexpressed Mouse Recombinant Protein
PROTQ64299	BosterBio	Regular: 20ug	EUR 317
Description: NOV Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 333 amino acids and having a molecular mass of 36.4kDa.;The NOV is purified by proprietary chromatographic techniques.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), APC-Cy7
4-PAG309Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Gly139~Met357) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC-Cy7.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG309Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Pro150~Ile354) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC-Cy7.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), APC
4-PAG309Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Ala156~Met351) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAG309Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Ala156~Met351) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Biotin.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAG309Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Ala156~Met351) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Cy3.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), FITC
4-PAG309Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Ala156~Met351) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with FITC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), HRP
4-PAG309Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Ala156~Met351) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with HRP.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), PE
4-PAG309Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NOV (Ala156~Met351) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with PE.

Human Nephroblastoma Overexpressed Gene (NOV) Protein (Active)
20-abx655782	Abbexa	EUR 1024.00 EUR 356.00 EUR 3390.00 EUR 1247.00 EUR 704.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

NOV sgRNA CRISPR Lentivector (Human) (Target 1)
K1442702	ABM	1.0 ug DNA	EUR 154

NOV sgRNA CRISPR Lentivector (Human) (Target 2)
K1442703	ABM	1.0 ug DNA	EUR 154

NOV sgRNA CRISPR Lentivector (Human) (Target 3)
K1442704	ABM	1.0 ug DNA	EUR 154

Nov sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3425702	ABM	1.0 ug DNA	EUR 154

Nov sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3425703	ABM	1.0 ug DNA	EUR 154

Nov sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3425704	ABM	1.0 ug DNA	EUR 154

Human Nephroblastoma Overexpressed Gene, NOV ELISA Kit
DEIA136	Creative Diagnostics	10 plates	EUR 2495
Description: Human NOV ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant NOV in a sandwich ELISA format within the range of 63-4,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagents to assay NOV in approximately 1,000 ELISA plate wells.

Nov sgRNA CRISPR Lentivector (Rat) (Target 1)
K7089502	ABM	1.0 ug DNA	EUR 154

Nov sgRNA CRISPR Lentivector (Rat) (Target 2)
K7089503	ABM	1.0 ug DNA	EUR 154

Nov sgRNA CRISPR Lentivector (Rat) (Target 3)
K7089504	ABM	1.0 ug DNA	EUR 154

Recombinant Mouse NOV Protein, Untagged, E.coli-1mg
QP10796-1mg	EnQuireBio	1mg	EUR 3556

Recombinant Mouse NOV Protein, Untagged, E.coli-20ug
QP10796-20ug	EnQuireBio	20ug	EUR 201

Recombinant Mouse NOV Protein, Untagged, E.coli-5ug
QP10796-5ug	EnQuireBio	5ug	EUR 155

Nov Protein Vector (Human) (pPB-C-His)
PV028661	ABM	500 ng	EUR 329

Nov Protein Vector (Human) (pPB-N-His)
PV028662	ABM	500 ng	EUR 329

Nov Protein Vector (Human) (pPM-C-HA)
PV028663	ABM	500 ng	EUR 329

Nov Protein Vector (Human) (pPM-C-His)
PV028664	ABM	500 ng	EUR 329

Nov Protein Vector (Mouse) (pPB-C-His)
PV206166	ABM	500 ng	EUR 603

Nov Protein Vector (Mouse) (pPB-N-His)
PV206167	ABM	500 ng	EUR 603

NOV Antibody