NOV Antibody 

To Order Contact us:

NOV antibody

70R-1714 100 ug
EUR 377
Description: Rabbit polyclonal NOV antibody raised against the middle region of NOV

NOV antibody

70R-1715 100 ug
EUR 377
Description: Rabbit polyclonal NOV antibody raised against the C terminal of NOV

NOV Antibody

36547-100ul 100ul
EUR 252

NOV Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NOV. Recognizes NOV from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NOV Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOV. Recognizes NOV from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

NOV Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NOV. Recognizes NOV from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NOV antibody

70R-NR012 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal NOV antibody

Nov Polyclonal Antibody

41797-100ul 100ul
EUR 252

Nov Polyclonal Antibody

41797-50ul 50ul
EUR 187

Norovirus (NOV) Antibody

abx023841-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx023842-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx023843-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx023844-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx023845-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx023846-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx023847-1mg 1 mg
EUR 843
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx022119-1mg 1 mg
EUR 940
  • Shipped within 5-10 working days.

Norovirus (NOV) Antibody

abx022120-1mg 1 mg
EUR 940
  • Shipped within 5-10 working days.

NOV Conjugated Antibody

C36547 100ul
EUR 397

Nov Polyclonal Antibody

ABP53143-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nov
  • Applications tips:
Description: A polyclonal antibody for detection of Nov from Human, Mouse. This Nov antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nov

Nov Polyclonal Antibody

ABP53143-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nov
  • Applications tips:
Description: A polyclonal antibody for detection of Nov from Human, Mouse. This Nov antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nov

Nov Polyclonal Antibody

ABP53143-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nov
  • Applications tips:
Description: A polyclonal antibody for detection of Nov from Human, Mouse. This Nov antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nov

Nov Polyclonal Antibody

ES4142-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nov from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Nov Polyclonal Antibody

ES4142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nov from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- NOV antibody

FNab05801 100µg
EUR 505.25
  • Immunogen: nephroblastoma overexpressed gene
  • Uniprot ID: P48745
  • Gene ID: 4856
  • Research Area: Immunology, Cardiovascular, Signal Transduction
Description: Antibody raised against NOV

Anti-NOV antibody

PAab05801 100 ug
EUR 355

Anti-NOV antibody

STJ27273 100 µl
EUR 277
Description: The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development.

Anti-NOV antibody

STJ116698 100 µl
EUR 277
Description: The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. CNN family proteins associate with the extracellular matrix and play an important role in cardiovascular and skeletal development, fibrosis and cancer development.

Anti-Nov antibody

STJ96777 200 µl
EUR 197
Description: Rabbit polyclonal to Nov.

Nov/ Rat Nov ELISA Kit

ELI-35315r 96 Tests
EUR 886

Mouse Protein NOV Homolog (NOV) Protein

  • EUR 4365.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Protein NOV Homolog (NOV) Protein

  • EUR 4379.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Chicken Protein NOV, NOV ELISA KIT

ELI-38132c 96 Tests
EUR 928

NOV protein

30R-AN038 20 ug
EUR 273
Description: Purified recombinant Human NOV protein


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-NOV/CCN3 Antibody

A06319-1 100ug/vial
EUR 334

Human Protein NOV homolog(NOV) ELISA kit

CSB-EL015956HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Protein NOV homolog (NOV) in samples from serum, plasma, tissue homogenates . A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protein NOV homolog(NOV) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Protein NOV homolog(NOV) in samples from serum, plasma, tissue homogenates . Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein NOV homolog(NOV) ELISA kit

CSB-EL015956MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein NOV homolog (NOV) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Protein NOV homolog(NOV) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein NOV homolog(NOV) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Protein NOV homolog(NOV) ELISA kit

CSB-EL015956RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein NOV homolog (NOV) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Protein NOV homolog(NOV) ELISA kit

  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Protein NOV homolog(NOV) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Protein NOV homolog, Nov ELISA KIT

ELI-14991m 96 Tests
EUR 865

Human Protein NOV homolog, NOV ELISA KIT

ELI-35314h 96 Tests
EUR 824

NOV Rabbit pAb

A14488-100ul 100 ul
EUR 308

NOV Rabbit pAb

A14488-200ul 200 ul
EUR 459

NOV Rabbit pAb

A14488-20ul 20 ul
EUR 183

NOV Rabbit pAb

A14488-50ul 50 ul
EUR 223

NOV Blocking Peptide

33R-4680 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOV antibody, catalog no. 70R-1715

NOV Blocking Peptide

33R-8084 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOV antibody, catalog no. 70R-1714

NOV cloning plasmid

CSB-CL015956HU-10ug 10ug
EUR 411
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1074
  • Sequence: atgcagagtgtgcagagcacgagcttttgtctccgaaagcagtgcctttgcctgaccttcctgcttctccatctcctgggacaggtcgctgcgactcagcgctgccctccccagtgcccgggccggtgccctgcgacgccgccgacctgcgcccccggggtgcgcgcggtgctgg
  • Show more
Description: A cloning plasmid for the NOV gene.

NOV Rabbit pAb

A5320-100ul 100 ul
EUR 308

NOV Rabbit pAb

A5320-200ul 200 ul
EUR 459

NOV Rabbit pAb

A5320-20ul 20 ul
EUR 183

NOV Rabbit pAb

A5320-50ul 50 ul
EUR 223


PVT13271 2 ug
EUR 391

Nephroblastoma Overexpressed Gene (NOV) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nephroblastoma Overexpressed Gene (NOV) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nephroblastoma Overexpressed Gene (NOV) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nephroblastoma Overexpressed Gene (NOV) Antibody

abx235801-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Polyclonal CCN3 / NOV Antibody (C-Terminus)

APR02446G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCN3 / NOV (C-Terminus). This antibody is tested and proven to work in the following applications:


EF001289 96 Tests
EUR 689

Mouse NOV shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NOV shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOV shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human NOV Protein

PROTP48745-2 20ug
EUR 317
Description: NOV is a member of the CCN family of secreted cysteine rich regulatory proteins. The full length NOV protein contains four structural domains that confer distinct, and sometimes opposing, biological activities. Elevated expression of NOV is associated with certain tumors, including Wilm’s tumor and most nephroblastomas. However, in other tumor types and certain cancer cell lines, increased tumorgenicity and proliferation is correlated with decreased NOV expression. Additionally, NOV induces cell adhesion and cell migration by signaling through specific cell surface integrins and by binding to heparin sulfate proteoglycans and to fibulin 1C. NOV has also been reported to exert proangiogenic activities. Recombinant human NOV is a 36.2 kDa protein containing 331 amino acid residues. It is composed of four distinct structural domains (modules); the IGF binding protein (IGFBP) domain, the von Willebrand Factor C (VWFC) domain, the Thrombospondin type-I (TSP type-1) domain, and a C-terminal cysteine knot-like domain (CTCK).

Recombinant NoV VP1 Protein

VAng-Wyb3670-50g 50 µg
EUR 1411
Description: Norovirus VP1, recombinant protein.

Monoclonal NOV Antibody (monoclonal) (M01), Clone: 3C2

AMM03865G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NOV (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3C2. This antibody is applicable in WB, E

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV)

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV)

Mouse Norovirus (NoV) ELISA Kit

abx055035-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Human Norovirus (NoV) ELISA Kit

abx055762-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.


LF-EK50926 1×96T
EUR 648

Human CellExp? NOV, human recombinant

EUR 196

Human CellExp? NOV, human recombinant

EUR 294

Nov ORF Vector (Rat) (pORF)

ORF071423 1.0 ug DNA
EUR 506

NOV ORF Vector (Human) (pORF)

ORF007166 1.0 ug DNA
EUR 95

Nov ORF Vector (Mouse) (pORF)

ORF051542 1.0 ug DNA
EUR 506

Recombinant Nephroblastoma Overexpressed Gene (NOV)

  • EUR 460.19
  • EUR 226.00
  • EUR 1450.72
  • EUR 550.24
  • EUR 1000.48
  • EUR 371.00
  • EUR 3476.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P48745
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 54.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Nephroblastoma Overexpressed Gene expressed in: E.coli

Recombinant Nephroblastoma Overexpressed Gene (NOV)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q64299
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.5kDa
  • Isoelectric Point: 8.4
Description: Recombinant Mouse Nephroblastoma Overexpressed Gene expressed in: E.coli

Recombinant Nephroblastoma Overexpressed Gene (NOV)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QZQ5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Nephroblastoma Overexpressed Gene expressed in: E.coli

Recombinant human NOV/CCN3 Protein

RP01186 10 μg
EUR 183

NOV ELISA Kit (Human) (OKBB00827)

OKBB00827 96 Wells
EUR 505
Description: Description of target: NOV(nephroblastoma overexpressed), also known as CCN3, is a matricellular protein that in humans is encoded by the NOV gene. The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. This gene is mapped to 8q24.12. NOV is a potentially useful marker for the diagnosis of adrenal gland diseases, malignant adrenocortical tumors, multiple sclerosis and so on. Moreover, reduced expression of NOV in ACTs may play an important role in the process of childhood ACT tumorigenesis. Though studying, it identified Nov as a regulator of human hematopoietic stem or progenitor cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <2pg/ml

NOV ELISA Kit (Mouse) (OKBB00828)

OKBB00828 96 Wells
EUR 505
Description: Description of target: NOV (nephroblastoma overexpressed), also known as CCN3, is a matricellular protein that in humans is encoded by the NOV gene. The protein encoded by this gene is a small secreted cysteine-rich protein and a member of the CCN family of regulatory proteins. This gene is mapped to 8q24.12. NOV is a potentially useful marker for the diagnosis of adrenal gland diseases, malignant adrenocortical tumors, multiple sclerosis and so on. Moreover, reduced expression of NOV in ACTs may play an important role in the process of childhood ACT tumorigenesis. Though studying, it identified Nov as a regulator of human hematopoietic stem or progenitor cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

NOV ELISA Kit (Rat) (OKCA00996)

OKCA00996 96 Wells
EUR 833
Description: Description of target: Immediate-early protein playing a role in various cellular processes including proliferation, adhesion, migration, differentiation and survival. Acts by binding to integrins or membrane receptors such as NOTCH1. Essential regulator of hematopoietic stem and progenitor cell function. Inhibits myogenic differentiation through the activation of Notch-signaling pathway. Inhibits vascular smooth muscle cells proliferation by increasing expression of cell-cycle regulators such as CDKN2B or CDKN1A independently of TGFB1 signaling. Ligand of integrins ITGAV:ITGB3 and ITGA5:ITGB1, acts directly upon endothelial cells to stimulate pro-angiogenic activities and induces angiogenesis. In endothelial cells, supports cell adhesion, induces directed cell migration (chemotaxis) and promotes cell survival. Plays also a role in cutaneous wound healing acting as integrin receptor ligand. Supports skin fibroblast adhesion through ITGA5:ITGB1 and ITGA6:ITGB1 and induces fibroblast chemotaxis through ITGAV:ITGB5. Seems to enhance bFGF-induced DNA synthesis in fibroblasts. Involved in bone regeneration as a negative regulator. Enhances the articular chondrocytic phenotype, whereas it repressed the one representing endochondral ossification . Impairs pancreatic beta-cell function, inhibits beta-cell proliferation and insulin secretion. Plays a role as negative regulator of endothelial pro-inflammatory activation reducing monocyte adhesion, its anti-inflammatory effects occur secondary to the inhibition of NF-kappaB signaling pathway. Contributes to the control and coordination of inflammatory processes in atherosclerosis. Attenuates inflammatory pain through regulation of IL1B- and TNF-induced MMP9, MMP2 and CCL2 expression. Inhibits MMP9 expression through ITGB1 engagement .;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.81 ng/mL

NOV ELISA Kit (Mouse) (OKCA01755)

OKCA01755 96 Wells
EUR 846
Description: Description of target: Immediate-early protein playing a role in various cellular processes including proliferation, adhesion, migration, differentiation and survival. Acts by binding to integrins or membrane receptors such as NOTCH1. Essential regulator of hematopoietic stem and progenitor cell function. Inhibits myogenic differentiation through the activation of Notch-signaling pathway. Inhibits vascular smooth muscle cells proliferation by increasing expression of cell-cycle regulators such as CDKN2B or CDKN1A independently of TGFB1 signaling. Ligand of integrins ITGAV:ITGB3 and ITGA5:ITGB1, acts directly upon endothelial cells to stimulate pro-angiogenic activities and induces angiogenesis. In endothelial cells, supports cell adhesion, induces directed cell migration (chemotaxis) and promotes cell survival. Plays also a role in cutaneous wound healing acting as integrin receptor ligand. Supports skin fibroblast adhesion through ITGA5:ITGB1 and ITGA6:ITGB1 and induces fibroblast chemotaxis through ITGAV:ITGB5. Seems to enhance bFGF-induced DNA synthesis in fibroblasts. Involved in bone regeneration as a negative regulator (PubMed:23653360). Enhances the articular chondrocytic phenotype, whereas it repressed the one representing endochondral ossification. Impairs pancreatic beta-cell function, inhibits beta-cell proliferation and insulin secretion (PubMed:23705021). Plays a role as negative regulator of endothelial pro-inflammatory activation reducing monocyte adhesion, its anti-inflammatory effects occur secondary to the inhibition of NF-kappaB signaling pathway. Contributes to the control and coordination of inflammatory processes in atherosclerosis (PubMed:24722330). Attenuates inflammatory pain through regulation of IL1B- and TNF-induced MMP9, MMP2 and CCL2 expression. Inhibits MMP9 expression through ITGB1 engagement.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.85 pg/mL

Monoclonal CCN3 / NOV Antibody (clone 2G8), Clone: 2G8

AMM02123G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human CCN3 / NOV (clone 2G8). The antibodies are raised in Mouse and are from clone 2G8. This antibody is applicable in WB and IHC-P, E, IP

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Biotin.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Cy3.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with FITC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with HRP.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with PE.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Biotin.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Cy3.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with FITC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with HRP.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with PE.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Ala156~Met351)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV)

Mouse Nephroblastoma Overexpressed Gene (NOV) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Nephroblastoma Overexpressed Gene (NOV) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human NOV/CCN3

EK5373 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human NOV/CCN3 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse NOV/CCN3

EK5374 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse NOV/CCN3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NOV/CCN3 PicoKine ELISA Kit

EK0833 96 wells
EUR 425
Description: For quantitative detection of human NOV in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse NOV/CCN3 PicoKine ELISA Kit

EK0834 96 wells
EUR 425
Description: For quantitative detection of mouse NOV in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human NOV(Nephroblastoma overexpressed)ELISA Kit

EH10616 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Nephroblastoma Overexpressed Gene (NOV) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1957.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nov sgRNA CRISPR Lentivector set (Rat)

K7089501 3 x 1.0 ug
EUR 339

Nov sgRNA CRISPR Lentivector set (Mouse)

K3425701 3 x 1.0 ug
EUR 339

NOV sgRNA CRISPR Lentivector set (Human)

K1442701 3 x 1.0 ug
EUR 339

NOV Nephroblastoma Overexpressed Human Recombinant Protein

PROTP48745 Regular: 20ug
EUR 317
Description: Nephroblastoma Overexpressed Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 331 amino acids and having a molecular mass of 36.2 kDa. The NOV is purified by proprietary chromatographic techniques.

NOV Nephroblastoma Overexpressed Mouse Recombinant Protein

PROTQ64299 Regular: 20ug
EUR 317
Description: NOV Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 333 amino acids and having a molecular mass of 36.4kDa.;The NOV is purified by proprietary chromatographic techniques.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Gly139~Met357)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC-Cy7.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Pro150~Ile354)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC-Cy7.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Ala156~Met351)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with APC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Ala156~Met351)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Biotin.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Ala156~Met351)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with Cy3.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Ala156~Met351)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with FITC.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Ala156~Met351)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with HRP.

Nephroblastoma Overexpressed Gene (NOV) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOV (Ala156~Met351)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Nephroblastoma Overexpressed Gene (NOV). This antibody is labeled with PE.

Human Nephroblastoma Overexpressed Gene, NOV ELISA Kit

DEIA136 10 plates
EUR 2495
Description: Human NOV ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant NOV in a sandwich ELISA format within the range of 63-4,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagents to assay NOV in approximately 1,000 ELISA plate wells.

Human Nephroblastoma Overexpressed Gene (NOV) Protein (Active)

  • EUR 1024.00
  • EUR 356.00
  • EUR 3390.00
  • EUR 1247.00
  • EUR 704.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Nov sgRNA CRISPR Lentivector (Rat) (Target 1)

K7089502 1.0 ug DNA
EUR 154

Nov sgRNA CRISPR Lentivector (Rat) (Target 2)

K7089503 1.0 ug DNA
EUR 154

Nov sgRNA CRISPR Lentivector (Rat) (Target 3)

K7089504 1.0 ug DNA
EUR 154

Nov sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3425702 1.0 ug DNA
EUR 154

Nov sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3425703 1.0 ug DNA
EUR 154

Nov sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3425704 1.0 ug DNA
EUR 154

NOV sgRNA CRISPR Lentivector (Human) (Target 1)

K1442702 1.0 ug DNA
EUR 154

NOV sgRNA CRISPR Lentivector (Human) (Target 2)

K1442703 1.0 ug DNA
EUR 154

NOV sgRNA CRISPR Lentivector (Human) (Target 3)

K1442704 1.0 ug DNA
EUR 154

Nov Protein Vector (Rat) (pPB-C-His)

PV285690 500 ng
EUR 603

Nov Protein Vector (Rat) (pPB-N-His)

PV285691 500 ng
EUR 603

Nov Protein Vector (Rat) (pPM-C-HA)

PV285692 500 ng
EUR 603

Nov Protein Vector (Rat) (pPM-C-His)

PV285693 500 ng
EUR 603

Nov Protein Vector (Mouse) (pPB-C-His)

PV206166 500 ng
EUR 603

Nov Protein Vector (Mouse) (pPB-N-His)

PV206167 500 ng
EUR 603

Nov Protein Vector (Mouse) (pPM-C-HA)

PV206168 500 ng
EUR 603

Nov Protein Vector (Mouse) (pPM-C-His)

PV206169 500 ng
EUR 603

Nov Protein Vector (Human) (pPB-C-His)

PV028661 500 ng
EUR 329

NOV Antibody