Human FLCN(Folliculin) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Folliculin (FLCN) ELISA Kit

RD-FLCN-Hu-48Tests 48 Tests
EUR 521

Human Folliculin (FLCN) ELISA Kit

RD-FLCN-Hu-96Tests 96 Tests
EUR 723

Human Folliculin (FLCN) ELISA Kit

RDR-FLCN-Hu-48Tests 48 Tests
EUR 544

Human Folliculin (FLCN) ELISA Kit

RDR-FLCN-Hu-96Tests 96 Tests
EUR 756

Human Folliculin, FLCN ELISA KIT

ELI-26737h 96 Tests
EUR 824

Human Folliculin (FLCN) ELISA Kit

20-abx151577
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Folliculin(FLCN) ELISA kit

CSB-EL008711HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin (FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Folliculin(FLCN) ELISA kit

1-CSB-EL008711HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin(FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

4-SEJ102Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Folliculin elisa. Alternative names of the recognized antigen: BHD
  • FLCL
  • BHD skin lesion fibrofolliculoma protein
  • Birt-Hogg-Dube syndrome protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Folliculin (FLCN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Bovine Folliculin, FLCN ELISA KIT

ELI-32494b 96 Tests
EUR 928

Mouse Folliculin, Flcn ELISA KIT

ELI-32528m 96 Tests
EUR 865

Mouse Folliculin (FLCN) ELISA Kit

abx389320-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Folliculin (FLCN) ELISA Kit

abx391347-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Folliculin (FLCN) Antibody

20-abx126912
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

20-abx112567
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

20-abx100526
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Folliculin (FLCN) Antibody

abx034049-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

abx034049-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

20-abx004978
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

20-abx172456
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Folliculin (FLCN) Antibody

20-abx176486
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Folliculin (FLCN) Antibody

20-abx176487
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Folliculin (FLCN) Antibody

20-abx213763
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

20-abx214841
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

abx233157-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ELISA kit for Human FLCN (Folliculin)

ELK3954 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Folliculin (FLCN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Folliculin (FLCN
  • Show more
Description: A sandwich ELISA kit for detection of Folliculin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Folliculin (FLCN) CLIA Kit

20-abx495616
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Folliculin (FLCN) Protein

20-abx653446
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Flcn ELISA Kit| Rat Folliculin ELISA Kit

EF018702 96 Tests
EUR 689

Flcn ELISA Kit| Mouse Folliculin ELISA Kit

EF014951 96 Tests
EUR 689

FLCN ELISA Kit| Bovine Folliculin ELISA Kit

EF011395 96 Tests
EUR 689

Folliculin (FLCN) Antibody (Biotin)

20-abx271837
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Flcn/ Rat Flcn ELISA Kit

ELI-26711r 96 Tests
EUR 886

FLCN ELISA KIT|Human

EF009648 96 Tests
EUR 689

FLCN ELISA Kit (Human) (OKCD01982)

OKCD01982 96 Wells
EUR 831
Description: Description of target: May be a tumor suppressor. May be involved in energy and/or nutrient sensing through the AMPK and mTOR signaling pathways. May regulate phosphorylation of RPS6KB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

FLCN ELISA Kit (Human) (OKCA02102)

OKCA02102 96 Wells
EUR 833
Description: Description of target: May be a tumor suppressor. May be involved in energy and/or nutrient sensing through the AMPK and mTOR signaling pathways. May regulate phosphorylation of RPS6KB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Recombinant human FLCN

P1429 100ug Ask for price
  • Uniprot ID: Q8NFG4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human FLCN

Human Folliculin- interacting protein 1, FNIP1 ELISA KIT

ELI-09886h 96 Tests
EUR 824

Human Folliculin- interacting protein 2, FNIP2 ELISA KIT

ELI-27534h 96 Tests
EUR 824

Human Folliculin Interacting Protein 1 (FNIP1) ELISA Kit

abx387393-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

FLCN siRNA

20-abx901981
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLCN siRNA

20-abx916958
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLCN siRNA

20-abx916959
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLCN Antibody

36486-100ul 100ul
EUR 252

FLCN antibody

38963-100ul 100ul
EUR 252

FLCN antibody

70R-17318 50 ul
EUR 435
Description: Rabbit polyclonal FLCN antibody

FLCN antibody

70R-10330 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FLCN antibody

FLCN antibody

70R-10331 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FLCN antibody

FLCN Antibody

DF12608 200ul
EUR 304
Description: FLCN Antibody detects endogenous levels of FLCN.

FLCN Antibody

1-CSB-PA797254
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

FLCN Antibody

1-CSB-PA549292
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

FLCN Antibody

1-CSB-PA008711GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

FLCN Antibody

1-CSB-PA008711HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-FLCN

YF-PA22691 50 ug
EUR 363
Description: Mouse polyclonal to FLCN

anti-FLCN

YF-PA26966 50 ul
EUR 334
Description: Mouse polyclonal to FLCN

anti-FLCN

YF-PA26967 50 ul
EUR 334
Description: Mouse polyclonal to FLCN

Human FLCN shRNA Plasmid

20-abx966277
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLCN Recombinant Protein (Human)

RP012259 100 ug Ask for price

Mouse Folliculin- interacting protein 1, Fnip1 ELISA KIT

ELI-27518m 96 Tests
EUR 865

Chicken Folliculin- interacting protein 1, FNIP1 ELISA KIT

ELI-32867c 96 Tests
EUR 928

Mouse Folliculin- interacting protein 2, Fnip2 ELISA KIT

ELI-47311m 96 Tests
EUR 865

FLCN Conjugated Antibody

C36486 100ul
EUR 397

FLCN cloning plasmid

CSB-CL008711HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1029
  • Sequence: atgaatgccatcgtggctctctgccacttctgcgagctccacggcccccgcactctcttctgcacggaggtgctgcacgccccacttcctcaaggggatgggaatgaggacagtcctggccagggtgagcaggcggaagaagaggaaggtggcattcagatgaacagtcggatgc
  • Show more
Description: A cloning plasmid for the FLCN gene.

anti- FLCN antibody

FNab03157 100µg
EUR 505.25
  • Immunogen: folliculin
  • Uniprot ID: Q8NFG4
  • Gene ID: 201163
  • Research Area: Cancer
Description: Antibody raised against FLCN

Anti-FLCN Antibody

A00718-1 100ug/vial
EUR 294

FLCN Rabbit pAb

A11849-100ul 100 ul
EUR 308

FLCN Rabbit pAb

A11849-200ul 200 ul
EUR 459

FLCN Rabbit pAb

A11849-20ul 20 ul Ask for price

FLCN Rabbit pAb

A11849-50ul 50 ul Ask for price

FLCN Rabbit pAb

A14521-100ul 100 ul
EUR 308

FLCN Rabbit pAb

A14521-200ul 200 ul
EUR 459

FLCN Rabbit pAb

A14521-20ul 20 ul
EUR 183

FLCN Rabbit pAb

A14521-50ul 50 ul
EUR 223

FLCN Rabbit pAb

A6493-100ul 100 ul
EUR 308

FLCN Rabbit pAb

A6493-200ul 200 ul
EUR 459

FLCN Rabbit pAb

A6493-20ul 20 ul
EUR 183

FLCN Rabbit pAb

A6493-50ul 50 ul
EUR 223

FLCN Blocking Peptide

33R-10310 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FLCN antibody, catalog no. 70R-10331

FLCN Blocking Peptide

33R-2358 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FLCN antibody, catalog no. 70R-10330

FLCN Blocking Peptide

DF12608-BP 1mg
EUR 195

Anti-FLCN antibody

PAab03157 100 ug
EUR 355

pENTR223-FLCN vector

PVT11942 2 ug
EUR 308

pCMV-SPORT6-FLCN

PVT13195 2 ug
EUR 391

Anti-FLCN antibody

STJ28576 100 µl
EUR 277
Description: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms.

Anti-FLCN antibody

STJ113428 100 µl
EUR 277
Description: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms.

Anti-FLCN antibody

STJ116732 100 µl
EUR 277
Description: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms.

FLCN ORF Vector (Human) (pORF)

ORF004087 1.0 ug DNA
EUR 95

Recombinant human Folliculin-interacting protein 2

P1230 100ug Ask for price
  • Uniprot ID: Q9P278
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Folliculin-interacting protein 2

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Polyclonal FLCN Antibody (Center)

APR06111G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLCN (Center). This antibody is tested and proven to work in the following applications:

Mouse FLCN shRNA Plasmid

20-abx981033
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FLCN shRNA Plasmid

20-abx989180
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLCN Antibody, HRP conjugated

1-CSB-PA008711HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FLCN Antibody, FITC conjugated

1-CSB-PA008711HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FLCN Antibody, Biotin conjugated

1-CSB-PA008711HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FLCN Recombinant Protein (Rat)

RP201512 100 ug Ask for price

FLCN Recombinant Protein (Mouse)

RP134768 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

FLCN sgRNA CRISPR Lentivector set (Human)

K0786801 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Folliculin Interacting Protein 1 (FNIP1) Antibody

20-abx313611
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Folliculin Interacting Protein 1 (FNIP1) Antibody

abx432703-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Folliculin Interacting Protein 1 (FNIP1) Antibody

abx448561-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Folliculin Interacting Protein 1 (FNIP1) Antibody

abx233179-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Flcn ORF Vector (Rat) (pORF)

ORF067172 1.0 ug DNA
EUR 506

Flcn ORF Vector (Mouse) (pORF)

ORF044924 1.0 ug DNA
EUR 506

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human FLCN(Folliculin) ELISA Kit