Human FLCN(Folliculin) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Folliculin (FLCN) ELISA Kit
RD-FLCN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Folliculin (FLCN) ELISA Kit
RD-FLCN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Folliculin (FLCN) ELISA Kit
RDR-FLCN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Folliculin (FLCN) ELISA Kit
RDR-FLCN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Folliculin, FLCN ELISA KIT
ELI-26737h	Lifescience Market	96 Tests	EUR 824

Human Folliculin (FLCN) ELISA Kit
20-abx151577	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Folliculin(FLCN) ELISA kit
CSB-EL008711HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin (FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Folliculin(FLCN) ELISA kit
1-CSB-EL008711HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin(FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Folliculin (FLCN) ELISA Kit
SEJ102Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit
SEJ102Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit
SEJ102Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit
SEJ102Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit
4-SEJ102Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Folliculin elisa. Alternative names of the recognized antigen: BHD FLCL BHD skin lesion fibrofolliculoma protein Birt-Hogg-Dube syndrome protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Folliculin (FLCN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Bovine Folliculin, FLCN ELISA KIT
ELI-32494b	Lifescience Market	96 Tests	EUR 928

Mouse Folliculin, Flcn ELISA KIT
ELI-32528m	Lifescience Market	96 Tests	EUR 865

Mouse Folliculin (FLCN) ELISA Kit
abx389320-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Folliculin (FLCN) ELISA Kit
abx391347-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Folliculin (FLCN) Antibody
20-abx126912	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Folliculin (FLCN) Antibody
20-abx112567	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Folliculin (FLCN) Antibody
20-abx100526	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Folliculin (FLCN) Antibody
abx034049-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Folliculin (FLCN) Antibody
abx034049-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Folliculin (FLCN) Antibody
20-abx004978	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Folliculin (FLCN) Antibody
20-abx172456	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Folliculin (FLCN) Antibody
20-abx176486	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Folliculin (FLCN) Antibody
20-abx176487	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Folliculin (FLCN) Antibody
20-abx213763	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Folliculin (FLCN) Antibody
20-abx214841	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Folliculin (FLCN) Antibody
abx233157-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

ELISA kit for Human FLCN (Folliculin)
ELK3954	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Folliculin (FLCN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Folliculin (FLCN Show more
Description: A sandwich ELISA kit for detection of Folliculin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Folliculin (FLCN) CLIA Kit
20-abx495616	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Folliculin (FLCN) Protein
20-abx653446	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Flcn ELISA Kit| Rat Folliculin ELISA Kit
EF018702	Lifescience Market	96 Tests	EUR 689

Flcn ELISA Kit| Mouse Folliculin ELISA Kit
EF014951	Lifescience Market	96 Tests	EUR 689

FLCN ELISA Kit| Bovine Folliculin ELISA Kit
EF011395	Lifescience Market	96 Tests	EUR 689

Folliculin (FLCN) Antibody (Biotin)
20-abx271837	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Flcn/ Rat Flcn ELISA Kit
ELI-26711r	Lifescience Market	96 Tests	EUR 886

FLCN ELISA KIT|Human
EF009648	Lifescience Market	96 Tests	EUR 689

FLCN ELISA Kit (Human) (OKCD01982)
OKCD01982	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May be a tumor suppressor. May be involved in energy and/or nutrient sensing through the AMPK and mTOR signaling pathways. May regulate phosphorylation of RPS6KB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

FLCN ELISA Kit (Human) (OKCA02102)
OKCA02102	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: May be a tumor suppressor. May be involved in energy and/or nutrient sensing through the AMPK and mTOR signaling pathways. May regulate phosphorylation of RPS6KB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Recombinant human FLCN
P1429	FN Test	100ug	Ask for price
Uniprot ID: Q8NFG4 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human FLCN

Human Folliculin- interacting protein 1, FNIP1 ELISA KIT
ELI-09886h	Lifescience Market	96 Tests	EUR 824

Human Folliculin- interacting protein 2, FNIP2 ELISA KIT
ELI-27534h	Lifescience Market	96 Tests	EUR 824

Human Folliculin Interacting Protein 1 (FNIP1) ELISA Kit
abx387393-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

FLCN siRNA
20-abx901981	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FLCN siRNA
20-abx916958	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FLCN siRNA
20-abx916959	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FLCN Antibody
36486-100ul	SAB	100ul	EUR 252

FLCN antibody
38963-100ul	SAB	100ul	EUR 252

FLCN antibody
70R-17318	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FLCN antibody

FLCN antibody
70R-10330	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal FLCN antibody

FLCN antibody
70R-10331	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal FLCN antibody

FLCN Antibody
DF12608	Affbiotech	200ul	EUR 304
Description: FLCN Antibody detects endogenous levels of FLCN.

FLCN Antibody
1-CSB-PA797254	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

FLCN Antibody
1-CSB-PA549292	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

FLCN Antibody
1-CSB-PA008711GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

FLCN Antibody
1-CSB-PA008711HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-FLCN
YF-PA22691	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FLCN

anti-FLCN
YF-PA26966	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to FLCN

anti-FLCN
YF-PA26967	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to FLCN

Human FLCN shRNA Plasmid
20-abx966277	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FLCN Recombinant Protein (Human)
RP012259	ABM	100 ug	Ask for price

Mouse Folliculin- interacting protein 1, Fnip1 ELISA KIT
ELI-27518m	Lifescience Market	96 Tests	EUR 865

Chicken Folliculin- interacting protein 1, FNIP1 ELISA KIT
ELI-32867c	Lifescience Market	96 Tests	EUR 928

Mouse Folliculin- interacting protein 2, Fnip2 ELISA KIT
ELI-47311m	Lifescience Market	96 Tests	EUR 865

FLCN Conjugated Antibody
C36486	SAB	100ul	EUR 397

FLCN cloning plasmid
CSB-CL008711HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1029 Sequence: atgaatgccatcgtggctctctgccacttctgcgagctccacggcccccgcactctcttctgcacggaggtgctgcacgccccacttcctcaaggggatgggaatgaggacagtcctggccagggtgagcaggcggaagaagaggaaggtggcattcagatgaacagtcggatgc Show more
Description: A cloning plasmid for the FLCN gene.

anti- FLCN antibody
FNab03157	FN Test	100µg	EUR 505.25
Immunogen: folliculin Uniprot ID: Q8NFG4 Gene ID: 201163 Research Area: Cancer
Description: Antibody raised against FLCN

Anti-FLCN Antibody
A00718-1	BosterBio	100ug/vial	EUR 294

FLCN Rabbit pAb
A11849-100ul	Abclonal	100 ul	EUR 308

FLCN Rabbit pAb
A11849-200ul	Abclonal	200 ul	EUR 459

FLCN Rabbit pAb
A11849-20ul	Abclonal	20 ul	Ask for price

FLCN Rabbit pAb
A11849-50ul	Abclonal	50 ul	Ask for price

FLCN Rabbit pAb
A14521-100ul	Abclonal	100 ul	EUR 308

FLCN Rabbit pAb
A14521-200ul	Abclonal	200 ul	EUR 459

FLCN Rabbit pAb
A14521-20ul	Abclonal	20 ul	EUR 183

FLCN Rabbit pAb
A14521-50ul	Abclonal	50 ul	EUR 223

FLCN Rabbit pAb
A6493-100ul	Abclonal	100 ul	EUR 308

FLCN Rabbit pAb
A6493-200ul	Abclonal	200 ul	EUR 459

FLCN Rabbit pAb
A6493-20ul	Abclonal	20 ul	EUR 183

FLCN Rabbit pAb
A6493-50ul	Abclonal	50 ul	EUR 223

FLCN Blocking Peptide
33R-10310	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FLCN antibody, catalog no. 70R-10331

FLCN Blocking Peptide
33R-2358	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FLCN antibody, catalog no. 70R-10330

FLCN Blocking Peptide
DF12608-BP	Affbiotech	1mg	EUR 195

Anti-FLCN antibody
PAab03157	Lifescience Market	100 ug	EUR 355

pENTR223-FLCN vector
PVT11942	Lifescience Market	2 ug	EUR 308

pCMV-SPORT6-FLCN
PVT13195	Lifescience Market	2 ug	EUR 391

Anti-FLCN antibody
STJ28576	St John's Laboratory	100 µl	EUR 277
Description: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms.

Anti-FLCN antibody
STJ113428	St John's Laboratory	100 µl	EUR 277
Description: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms.

Anti-FLCN antibody
STJ116732	St John's Laboratory	100 µl	EUR 277
Description: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms.

FLCN ORF Vector (Human) (pORF)
ORF004087	ABM	1.0 ug DNA	EUR 95

Recombinant human Folliculin-interacting protein 2
P1230	FN Test	100ug	Ask for price
Uniprot ID: Q9P278 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Folliculin-interacting protein 2

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Polyclonal FLCN Antibody (Center)
APR06111G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FLCN (Center). This antibody is tested and proven to work in the following applications:

Mouse FLCN shRNA Plasmid
20-abx981033	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat FLCN shRNA Plasmid
20-abx989180	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FLCN Antibody, HRP conjugated
1-CSB-PA008711HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FLCN Antibody, FITC conjugated
1-CSB-PA008711HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FLCN Antibody, Biotin conjugated
1-CSB-PA008711HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FLCN Recombinant Protein (Rat)
RP201512	ABM	100 ug	Ask for price

FLCN Recombinant Protein (Mouse)
RP134768	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

FLCN sgRNA CRISPR Lentivector set (Human)
K0786801	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Folliculin Interacting Protein 1 (FNIP1) Antibody
20-abx313611	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Folliculin Interacting Protein 1 (FNIP1) Antibody
abx432703-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Folliculin Interacting Protein 1 (FNIP1) Antibody
abx448561-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Folliculin Interacting Protein 1 (FNIP1) Antibody
abx233179-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Flcn ORF Vector (Rat) (pORF)
ORF067172	ABM	1.0 ug DNA	EUR 506

Flcn ORF Vector (Mouse) (pORF)
ORF044924	ABM	1.0 ug DNA	EUR 506

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human FLCN(Folliculin) ELISA Kit