Human PAM(Peptidylglycine Alpha Amidating Monooxygenase) ELISA Kit 

To Order Contact us:

Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
DLR-PAM-Hu-96T 96T
EUR 673
  • Should the Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
RD-PAM-Hu-48Tests 48 Tests
EUR 521
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
RD-PAM-Hu-96Tests 96 Tests
EUR 723
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
RDR-PAM-Hu-48Tests 48 Tests
EUR 544
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
RDR-PAM-Hu-96Tests 96 Tests
EUR 756
Active Peptidylglycine Alpha Amidating Monooxygenase (PAM)
  • EUR 973.60
  • EUR 364.00
  • EUR 3376.00
  • EUR 1192.00
  • EUR 2284.00
  • EUR 715.00
  • EUR 8290.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14925
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 77.7kDa
  • Isoelectric Point: 5.7
Description: Recombinant Rat Peptidylglycine Alpha Amidating Monooxygenase expressed in: 293F cell
Eukaryotic Peptidylglycine Alpha Amidating Monooxygenase (PAM)
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • EUR 996.00
  • EUR 1892.00
  • EUR 610.00
  • EUR 6820.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14925
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 77.7kDa
  • Isoelectric Point: 5.7
Description: Recombinant Rat Peptidylglycine Alpha Amidating Monooxygenase expressed in: 293F Cell
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Peptidylglycine Alpha Amidating Monooxygenase (PAM)
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P19021
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.7kDa
  • Isoelectric Point: 8.8
Description: Recombinant Human Peptidylglycine Alpha Amidating Monooxygenase expressed in: E.coli
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
SEC744Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
SEC744Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
SEC744Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
SEC744Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) in serum, plasma, tissue homogenates and other biological fluids.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Peptidylglycine Alpha Amidating Monooxygenase elisa. Alternative names of the recognized antigen: PAL
  • PHM
  • Peptidylamidoglycolate lyase
  • Peptidyl-Alpha-hydroxyglycine Alpha-amidating Lyase
  • Peptidylglycine Alpha-Hydroxylating Monooxyge
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Peptidylglycine Alpha Amidating Monooxygenase ELISA Kit (PAM)
RK02013 96 Tests
EUR 521
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) Protein
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human PAM (Peptidylglycine Alpha Amidating Monooxygenase)
ELK3953 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Peptidylglycine Alpha Amidating Monooxygenase (PAM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant
  • Show more
Description: A sandwich ELISA kit for detection of Peptidylglycine Alpha Amidating Monooxygenase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Peptidylglycine Alpha Amidating Monooxygenase (PAM) Protein (Active)
  • EUR 1066.00
  • EUR 398.00
  • EUR 3530.00
  • EUR 1288.00
  • EUR 732.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM)
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM). This antibody is labeled with APC.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM). This antibody is labeled with Biotin.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM). This antibody is labeled with Cy3.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM). This antibody is labeled with FITC.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM). This antibody is labeled with HRP.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM). This antibody is labeled with PE.
Peptidylglycine Alpha Amidating Monooxygenase (PAM) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PAM (Phe21~Cys288)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Peptidylglycine Alpha Amidating Monooxygenase (PAM). This antibody is labeled with APC-Cy7.
Peptidyl-Glycine Alpha-Amidating Monooxygenase (PAM) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Peptidyl-Glycine Alpha-Amidating Monooxygenase (PAM) Antibody
abx430037-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Mouse Peptidyl-glycine alpha-amidating monooxygenase (PAM) ELISA Kit
abx390184-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Peptidyl-glycine alpha-amidating monooxygenase (PAM) ELISA Kit
abx391786-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
ELISA kit for Human Peptidyl-glycine alpha-amidating monooxygenase (PAM)
KTE61310-48T 48T
EUR 332
  • Peptidyl-glycine alpha-amidating monooxygenase is a multifunctional protein. It has two enzymatically active domains with catalytic activities - peptidylglycine alpha-hydroxylating monooxygenase (PHM) and peptidyl-alpha-hydroxyglycine alpha-amidating
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peptidyl-glycine alpha-amidating monooxygenase (PAM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Peptidyl-glycine alpha-amidating monooxygenase (PAM)
KTE61310-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Peptidyl-glycine alpha-amidating monooxygenase is a multifunctional protein. It has two enzymatically active domains with catalytic activities - peptidylglycine alpha-hydroxylating monooxygenase (PHM) and peptidyl-alpha-hydroxyglycine alpha-amidating
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peptidyl-glycine alpha-amidating monooxygenase (PAM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Peptidyl-glycine alpha-amidating monooxygenase (PAM)
KTE61310-96T 96T
EUR 539
  • Peptidyl-glycine alpha-amidating monooxygenase is a multifunctional protein. It has two enzymatically active domains with catalytic activities - peptidylglycine alpha-hydroxylating monooxygenase (PHM) and peptidyl-alpha-hydroxyglycine alpha-amidating
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peptidyl-glycine alpha-amidating monooxygenase (PAM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Pam ELISA Kit| Rat Peptidyl-glycine alpha-amidating monooxygena
EF019146 96 Tests
EUR 689
Pam ELISA Kit| Mouse Peptidyl-glycine alpha-amidating monooxyge
EF015823 96 Tests
EUR 689
PAM ELISA Kit| Bovine Peptidyl-glycine alpha-amidating monooxyg
EF011727 96 Tests
EUR 689
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Pam/ Rat Pam ELISA Kit
ELI-11791r 96 Tests
EUR 886
ELI-11790h 96 Tests
EUR 824
EF005409 96 Tests
EUR 689
Human PAM PicoKine ELISA Kit
EK1765 96 wells
EUR 425
Description: For quantitative detection of human PAM in cell culture supernates, serum and plasma (heparin, EDTA, citrate).
PAM ELISA Kit (Human) (OKCD00762)
OKCD00762 96 Wells
EUR 831
Description: Description of target: Bifunctional enzyme that catalyzes 2 sequential steps in C-terminal alpha-amidation of peptides. The monooxygenase part produces an unstable peptidyl(2-hydroxyglycine) intermediate that is dismutated to glyoxylate and the corresponding desglycine peptide amide by the lyase part. C-terminal amidation of peptides such as neuropeptides is essential for full biological activity. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 13.5 pg/mL
PAM ELISA Kit (Human) (OKBB01218)
OKBB01218 96 Wells
EUR 505
Description: Description of target: Peptidyl-glycine alpha-amidating monooxygenase is an enzyme that catalyzes the biosynthesis of many signaling peptides and, in humans, is encoded by the PAM gene. It is mapped to 5q21.1. This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
Human CYP7A1/ Cholesterol 7-alpha-monooxygenase ELISA Kit
E0651Hu 1 Kit
EUR 571
ELISA kit for Human Cholesterol 7-alpha-monooxygenase
EK2656 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cholesterol 7-alpha-monooxygenase in samples from serum, plasma, tissue homogenates and other biological fluids.
Human CYP7A1(Cholesterol 7-alpha-monooxygenase) ELISA Kit
EH1191 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P22680
  • Alias: CYP7A1(Cytochrome P450 7A1)/Cholesterol 7-alpha-monooxygenase/CYPVII/Cholesterol 7-alpha-hydroxylase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Cholesterol 7- alpha- monooxygenase, CYP7A1 ELISA KIT
ELI-03412h 96 Tests
EUR 824
ELI-34657m 96 Tests
EUR 865
ELI-49244b 96 Tests
EUR 928
Rat Cyp7a1/ Cholesterol 7-alpha-monooxygenase ELISA Kit
E0281Ra 1 Kit
EUR 571
Rabbit Cholesterol 7- alpha- monooxygenase, CYP7A1 ELISA KIT
ELI-03409Ra 96 Tests
EUR 928
Porcine Cholesterol 7- alpha- monooxygenase, CYP7A1 ELISA KIT
ELI-03410p 96 Tests
EUR 928
Mouse Cholesterol 7- alpha- monooxygenase, Cyp7a1 ELISA KIT
ELI-03411m 96 Tests
EUR 865
Rat Cyp7a1(Cholesterol 7-alpha-monooxygenase) ELISA Kit
ER0426 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P18125
  • Alias: Cyp7a1/Cholesterol 7-alpha-monooxygenase/Cytochrome P450 7A1/CYPVII/Cholesterol 7-alpha-hydroxylase/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml
Mouse Cholesterol 7-alpha-monooxygenase(CYP7A1) ELISA kit
CSB-EL006460MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Cholesterol 7-alpha-monooxygenase(CYP7A1) ELISA kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Cholesterol 7-alpha-monooxygenase(CYP7A1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Recombinant human Cholesterol 7-alpha-monooxygenase
P2357 100ug Ask for price
  • Uniprot ID: P22680
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Cholesterol 7-alpha-monooxygenase
ELISA kit for Mouse Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE71348-48T 48T
EUR 332
  • CYP7A1 encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE71348-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CYP7A1 encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE71348-96T 96T
EUR 539
  • CYP7A1 encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Pig Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE80164-48T 48T
EUR 354
  • Cholesterol 7 alpha-hydroxylase also known as cholesterol 7-alpha-monooxygenase or cytochrome P450 7A1 (CYP7A1) is an enzyme that in humans is encoded by the CYP7A1 gene which has an important role in cholesterol metabolism. It is a cytochrome P450 e
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Pig Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE80164-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Cholesterol 7 alpha-hydroxylase also known as cholesterol 7-alpha-monooxygenase or cytochrome P450 7A1 (CYP7A1) is an enzyme that in humans is encoded by the CYP7A1 gene which has an important role in cholesterol metabolism. It is a cytochrome P450 e
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Pig Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE80164-96T 96T
EUR 572
  • Cholesterol 7 alpha-hydroxylase also known as cholesterol 7-alpha-monooxygenase or cytochrome P450 7A1 (CYP7A1) is an enzyme that in humans is encoded by the CYP7A1 gene which has an important role in cholesterol metabolism. It is a cytochrome P450 e
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE90116-48T 48T
EUR 354
  • CYP7A1 encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE90116-5platesof96wells 5 plates of 96 wells
EUR 2252
  • CYP7A1 encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Rabbit Cholesterol 7-alpha-monooxygenase (CYP7A1)
KTE90116-96T 96T
EUR 572
  • CYP7A1 encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Cholesterol 7-alpha-monooxygenase (CYP7A1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Cyp7a1 ELISA Kit| Rat Cholesterol 7-alpha-monooxygenase ELISA Ki
EF017271 96 Tests
EUR 689
Human Alkylglycerol monooxygenase(TMEM195) ELISA kit
E01A2009-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alkylglycerol monooxygenase(TMEM195) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alkylglycerol monooxygenase(TMEM195) ELISA kit
E01A2009-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alkylglycerol monooxygenase(TMEM195) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alkylglycerol monooxygenase(TMEM195) ELISA kit
E01A2009-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alkylglycerol monooxygenase(TMEM195) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human SQLE/ Squalene monooxygenase ELISA Kit
E2385Hu 1 Kit
EUR 605
Human Alkylglycerol monooxygenase, AGMO ELISA KIT
ELI-24195h 96 Tests
EUR 824
Kynurenine 3-monooxygenase ELISA Kit|Human
EF005180 96 Tests
EUR 689
Human Squalene monooxygenase, SQLE ELISA KIT
ELI-32784h 96 Tests
EUR 824
Human Alkylglycerol Monooxygenase (AGMO)ELISA Kit
201-12-2419 96 tests
EUR 440
  • This Alkylglycerol Monooxygenase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Alkylglycerol Monooxygenase(AGMO)ELISA Kit
QY-E01119 96T
EUR 361
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PAM antibody
70R-7168 50 ug
EUR 467
Description: Rabbit polyclonal PAM antibody raised against the N terminal of PAM
PAM Antibody
ABD8228 100 ug
EUR 438
PAM Antibody
45245-100ul 100ul
EUR 252
PAM Antibody
45245-50ul 50ul
EUR 187
PAM Antibody
DF8228 200ul
EUR 304
Description: PAM Antibody detects endogenous levels of total PAM.
PAM Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAM. Recognizes PAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200
Human PAM shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Kynurenine 3-monooxygenase (KMO) ELISA Kit
abx573591-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Kynurenine 3 monooxygenase(KMO) ELISA kit
E01K0092-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kynurenine 3 monooxygenase(KMO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Kynurenine 3 monooxygenase(KMO) ELISA kit
E01K0092-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kynurenine 3 monooxygenase(KMO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Kynurenine 3 monooxygenase(KMO) ELISA kit
E01K0092-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Kynurenine 3 monooxygenase(KMO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human KMO/ Kynurenine 3-monooxygenase ELISA Kit
E1395Hu 1 Kit
EUR 605
Human TH/ Tyrosine 3-monooxygenase ELISA Kit
E2487Hu 1 Kit
EUR 571
Human KMO(Kynurenine 3-monooxygenase) ELISA Kit
EH14776 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O15229
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human TH(Tyrosine 3-monooxygenase) ELISA Kit
EH1602 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P07101
  • Alias: TH(Tyrosine Hydroxylase)/TYH/DYT14/DYT5b/dystonia 14/Tyrosine 3-hydroxylase/Tyrosine 3-monooxygenase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Methylsterol monooxygenase 1, MSMO1 ELISA KIT
ELI-23191h 96 Tests
EUR 824
Human Tyrosine 3- monooxygenase, TH ELISA KIT
ELI-04696h 96 Tests
EUR 824
Human Kynurenine 3- monooxygenase, KMO ELISA KIT
ELI-46405h 96 Tests
EUR 824
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Methylsterol monooxygenase 1 (MSMO1) ELISA Kit
abx385151-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Coenzyme Q6, Monooxygenase (COQ6) ELISA Kit
abx386638-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
DLR-KMO-Hu-48T 48T
EUR 517
  • Should the Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kynurenine-3-Monooxygenase (KMO) in samples from tissue homogenates or other biological fluids.
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
DLR-KMO-Hu-96T 96T
EUR 673
  • Should the Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kynurenine-3-Monooxygenase (KMO) in samples from tissue homogenates or other biological fluids.
ELISA kit for Human Squalene monooxygenase (SQLE)
KTE60353-48T 48T
EUR 332
  • Squalene epoxidase (EC catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Squalene monooxygenase (SQLE)
KTE60353-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Squalene epoxidase (EC catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Squalene monooxygenase (SQLE)
KTE60353-96T 96T
EUR 539
  • Squalene epoxidase (EC catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Squalene epoxidase (SE) is a key flavin adenine dinucleotide (FAD)-dependent enzyme o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Squalene monooxygenase (SQLE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
RD-KMO-Hu-48Tests 48 Tests
EUR 521
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
RD-KMO-Hu-96Tests 96 Tests
EUR 723
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
RDR-KMO-Hu-48Tests 48 Tests
EUR 544
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
RDR-KMO-Hu-96Tests 96 Tests
EUR 756
Human Deoxyhypusine Hydroxylase/Monooxygenase(DOHH)ELISA Kit
QY-E01153 96T
EUR 361
Human Kynurenine-3-Monooxygenase(KMO)ELISA Kit
QY-E01801 96T
EUR 361
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
SEH755Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynurenine-3-Monooxygenase (KMO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynurenine-3-Monooxygenase (KMO) in Tissue homogenates and other biological fluids.
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
SEH755Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynurenine-3-Monooxygenase (KMO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynurenine-3-Monooxygenase (KMO) in Tissue homogenates and other biological fluids.
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
SEH755Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynurenine-3-Monooxygenase (KMO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynurenine-3-Monooxygenase (KMO) in Tissue homogenates and other biological fluids.
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
SEH755Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kynurenine-3-Monooxygenase (KMO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kynurenine-3-Monooxygenase (KMO) in Tissue homogenates and other biological fluids.
Human Kynurenine-3-Monooxygenase (KMO) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kynurenine-3-Monooxygenase elisa. Alternative names of the recognized antigen: Kynurenine 3-Hydroxylase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kynurenine-3-Monooxygenase (KMO) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
PAM Conjugated Antibody
C45245 100ul
EUR 397
PAM cloning plasmid
CSB-CL017417HU-10ug 10ug
EUR 838
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2601
  • Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat
  • Show more
Description: A cloning plasmid for the PAM gene.
PAM Rabbit pAb
A15077-100ul 100 ul
EUR 308

Human PAM(Peptidylglycine Alpha Amidating Monooxygenase) ELISA Kit