Large hybridization mesh, 23 x 23cm
To Order Contact us: stephen@expresspharmapulse.com
 ELISA test) CYFRA211 (Keratin 21-1) ELISA test |
|
23 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
|
Description: ELISA based test for quantitative detection of CYFRA211 (Keratin 21-1) |
) NATtrol BCID Panel (23 x 0.2mL) |
|
NATBCP-BIO |
Zeptometrix |
23 x 0.2mL |
EUR 948.56 |
- What is the product classification?
- NATtrol BCID Panel is marked as RUO.
|
|
Description: Please contact Gentaur in order to receive the datasheet of the product. |
 Hybridization cocktails I, 0% Formamide |
|
HD0137 |
Bio Basic |
25ml |
EUR 67.4 |
- Product category: Biochemicals/Biological Buffers/Hybridization Buffers
|
 Hybridization cocktails II, 50% Formamide |
|
HD0139 |
Bio Basic |
25ml |
EUR 67.4 |
- Product category: Biochemicals/Biological Buffers/Hybridization Buffers
|
 Hybridization cocktails III, 0% Formamide |
|
HD0143 |
Bio Basic |
25ml |
EUR 67.4 |
- Product category: Biochemicals/Biological Buffers/Hybridization Buffers
|
 Hybridization cocktails, IV 50% Formamide |
|
HD0147 |
Bio Basic |
25ml |
EUR 67.4 |
- Product category: Biochemicals/Biological Buffers/Hybridization Buffers
|
) Self-Sealing Sterilization Pouches, 23/4 x 9 (7 x 22.9 cm) |
|
LC3042-200 |
GenDepot |
200/bx |
EUR 68 |
) HIV Seroconversion Panel Donor# 75018 (23 X 1 mL) |
|
HIV9077 |
Zeptometrix |
23 X 1 mL |
EUR 2040.56 |
- What is the product classification?
- HIV Seroconversion Panel Donor# 75018 is marked as RUO.
|
|
Description: Please contact Gentaur in order to receive the datasheet of the product. |
) HBV Seroconversion Panel Donor# 67449 (23 X 1 mL) |
|
HBV11009 |
Zeptometrix |
23 X 1 mL |
EUR 859.12 |
- What is the product classification?
- HBV Seroconversion Panel Donor# 67449 is marked as RUO.
|
|
Description: Please contact Gentaur in order to receive the datasheet of the product. |
 (Ea)) NATtrol Respiratory Verification Panel 2 (23 x 0.6mL) (Ea) |
|
NATRVP2-BIO |
Zeptometrix |
23 x 0.6mL |
EUR 971.44 |
- What is the product classification?
- NATtrol Respiratory Verification Panel 2 is marked as RUO.
|
|
Description: Please contact Gentaur in order to receive the datasheet of the product. |
 LARGE antibody |
|
70R-6856 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE |
 LARGE siRNA |
|
20-abx922269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LARGE siRNA |
|
20-abx922270 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Interleukin-23/IL-23 |
|
E21-S31 |
EnoGene |
10ug |
EUR 343 |
 Kit for 20 slides) IsHyb In Situ Hybridization (ISH) Kit for 20 slides |
|
K2191020 |
Biochain |
1 kit |
EUR 235 |
|
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
 Kit for 50 slides) IsHyb In Situ Hybridization (ISH) Kit for 50 slides |
|
K2191050 |
Biochain |
1 kit |
EUR 398 |
|
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
 Rabbit Monoclonal Antibody, Clone#RM181) Anti-Dimethyl Histone H3 (Lys79) Rabbit Monoclonal Antibody, Clone#RM181 |
|
M06819-23 |
BosterBio |
100ug |
EUR 468 |
|
Description: Anti-Dimethyl Histone H3 (Lys79) Rabbit Monoclonal Antibody, Clone#RM181 tested in WB, ELISA, Multiplex, ChIP, IHC, reactive to All Vertebrates |
 IL-12, Interleukin-12, human |
|
RC212-23 |
Bio Basic |
2ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
 Endostatin, human |
|
RC214-23 |
Bio Basic |
20ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
 Betacellulin, human |
|
RC218-23 |
Bio Basic |
5ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Growth Factors
|
 S100B, monkey |
|
RC230-23 |
Bio Basic |
2ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Other
|
) Betacellulin, murine (mouse) |
|
RC238-23 |
Bio Basic |
5ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Growth Factors
|
) CCL12, murine (mouse) |
|
RC335-23 |
Bio Basic |
5ug |
EUR 101.33 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
, human) UBC12, Ubiquitin Conjugating Enzyme 12 (His6-tagged), human |
|
RC612-23 |
Bio Basic |
50ug |
EUR 169.63 |
- Product category: Proteins/Recombinant Proteins/Ubiquitins
|
 PMAxx) PMA Real-Time PCR Bacterial Viability Kit - Salmonella enterica (invA) PMAxx |
|
31033-X |
Biotium |
1kit |
EUR 428 |
|
Description: Minimum order quantity: 1 unit of 1kit |
 PMAxx) PMA Real-Time PCR Bacterial Viability Kit - E. coli O157:H7 (Z3276) PMAxx |
|
31037-X |
Biotium |
1kit |
EUR 428 |
|
Description: Minimum order quantity: 1 unit of 1kit |
 PMAxx) PMA Real-Time PCR Bacterial Viability Kit - E. coli (uidA) PMAxx |
|
31050-X |
Biotium |
1kit |
EUR 428 |
|
Description: Minimum order quantity: 1 unit of 1kit |
 PMAxx) PMA Real-Time PCR Bacterial Viability Kit - Listeria monocytogenes (hly) PMAxx |
|
31051-X |
Biotium |
1kit |
EUR 428 |
|
Description: Minimum order quantity: 1 unit of 1kit |
 Viability PCR Starter Kit with PMAxxâ„¢ |
|
31075-X |
Biotium |
1kit |
EUR 363 |
|
Description: Minimum order quantity: 1 unit of 1kit |
 Viability PCR Starter Kit with PMAxxâ„¢ and Enhancer |
|
31076-X |
Biotium |
1kit |
EUR 363 |
|
Description: Minimum order quantity: 1 unit of 1kit |
 Individual Reaction Mix |
|
G065-X |
ABM |
200 reactions |
EUR 167 |
 Antibody) Claudin 23 (Claudin 23) Antibody |
|
abx231737-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE |
|
EF012373 |
Lifescience Market |
96 Tests |
EUR 689 |
 LARGE Blocking Peptide |
|
33R-1247 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992 |
 Large-CRP OmcBProtein |
|
20-abx600013 |
Abbexa |
-
EUR 843.00
-
EUR 439.00
-
EUR 1274.00
-
EUR 1636.00
-
EUR 551.00
|
-
100 ug
-
10 ug
-
200 ug
-
500 ug
-
50 ug
|
|
|
Large-CRP OmcBProtein |
|
20-abx600014 |
Abbexa |
|
|
|
|
 LARGE cloning plasmid |
|
CSB-CL012749HU-10ug |
Cusabio |
10ug |
EUR 745 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2271
- Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
- Show more
|
|
Description: A cloning plasmid for the LARGE gene. |
 LARGE Rabbit pAb |
|
A19515-100ul |
Abclonal |
100 ul |
Ask for price |
LARGE Rabbit pAb |
|
A19515-200ul |
Abclonal |
200 ul |
Ask for price |
LARGE Rabbit pAb |
|
A19515-20ul |
Abclonal |
20 ul |
Ask for price |
Large hybridization mesh, 23 x 23cm
)