Large hybridization mesh, 23 x 23cm 

To Order Contact us:

CYFRA211 (Keratin 21-1) ELISA test

23 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CYFRA211 (Keratin 21-1)

NATtrol BCID Panel (23 x 0.2mL)

NATBCP-BIO 23 x 0.2mL
EUR 948.56
  • What is the product classification?
  • NATtrol BCID Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Hybridization cocktails I, 0% Formamide

HD0137 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Hybridization cocktails II, 50% Formamide

HD0139 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Hybridization cocktails III, 0% Formamide

HD0143 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Hybridization cocktails, IV 50% Formamide

HD0147 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Self-Sealing Sterilization Pouches, 23/4 x 9 (7 x 22.9 cm)

LC3042-200 200/bx
EUR 68

HIV Seroconversion Panel Donor# 75018 (23 X 1 mL)

HIV9077 23 X 1 mL
EUR 2040.56
  • What is the product classification?
  • HIV Seroconversion Panel Donor# 75018 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67449 (23 X 1 mL)

HBV11009 23 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

NATtrol Respiratory Verification Panel 2 (23 x 0.6mL) (Ea)

NATRVP2-BIO 23 x 0.6mL
EUR 971.44
  • What is the product classification?
  • NATtrol Respiratory Verification Panel 2 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

LARGE antibody

70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


E21-S31 10ug
EUR 343

IsHyb In Situ Hybridization (ISH) Kit for 20 slides

K2191020 1 kit
EUR 235
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

IsHyb In Situ Hybridization (ISH) Kit for 50 slides

K2191050 1 kit
EUR 398
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Anti-Dimethyl Histone H3 (Lys79) Rabbit Monoclonal Antibody, Clone#RM181

M06819-23 100ug
EUR 468
Description: Anti-Dimethyl Histone H3 (Lys79) Rabbit Monoclonal Antibody, Clone#RM181 tested in WB, ELISA, Multiplex, ChIP, IHC, reactive to All Vertebrates

IL-12, Interleukin-12, human

RC212-23 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Endostatin, human

RC214-23 20ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Betacellulin, human

RC218-23 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Growth Factors

S100B, monkey

RC230-23 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Other

Betacellulin, murine (mouse)

RC238-23 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Growth Factors

CCL12, murine (mouse)

RC335-23 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Cytokines

UBC12, Ubiquitin Conjugating Enzyme 12 (His6-tagged), human

RC612-23 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Ubiquitins

Florisil, 60 - 100 mesh

GE3010-100G 100 g
EUR 70

Florisil, 60 - 100 mesh

GE3010-250G 250 g
EUR 114

PMA Real-Time PCR Bacterial Viability Kit - Salmonella enterica (invA) PMAxx

31033-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - E. coli O157:H7 (Z3276) PMAxx

31037-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - E. coli (uidA) PMAxx

31050-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

PMA Real-Time PCR Bacterial Viability Kit - Listeria monocytogenes (hly) PMAxx

31051-X 1kit
EUR 428
Description: Minimum order quantity: 1 unit of 1kit

Viability PCR Starter Kit with PMAxxâ„¢

31075-X 1kit
EUR 363
Description: Minimum order quantity: 1 unit of 1kit

Viability PCR Starter Kit with PMAxxâ„¢ and Enhancer

31076-X 1kit
EUR 363
Description: Minimum order quantity: 1 unit of 1kit

Human Kinase Library (I, II, III and IV)

HKIN-X 1 set
EUR 1425

Individual Reaction Mix

G065-X 200 reactions
EUR 167

Claudin 23 (Claudin 23) Antibody

abx231737-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE

EF012373 96 Tests
EUR 689

LARGE Blocking Peptide

33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Large-CRP OmcBProtein

  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

LARGE cloning plasmid

CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.

LARGE Rabbit pAb

A19515-100ul 100 ul Ask for price

LARGE Rabbit pAb

A19515-200ul 200 ul Ask for price

LARGE Rabbit pAb

A19515-20ul 20 ul Ask for price

Large hybridization mesh, 23 x 23cm