1 mm Dual Mini Gel Cast 

To Order Contact us: stephen@expresspharmapulse.com

0.75 mm Compact Gel Cast

2393632 2unit
EUR 382
Description: I ncl udi ng 1 set of gl ass pl at es and 1 comb

0.75 mm Compact Multi Gel Cast

2322602 1unit
EUR 311
Description: I ncl udi ng 2 pai r s of gl ass pl at es, 2 combs, 3di vi der pl at e and 1 dummy pl at e. Ready t o cast t wo 12-wel l gel s

WSE-1190 Multi Mini-Slab Gel Cast

2393031 1unit
EUR 460

AE-6210 Slab Gel Cast, 1-mm 12-well

2392980 1unit
EUR 634
Description: I ncl udi ng 1 pai r of gl ass pl at es, 1 gask et , and 1comb. Ready t o cast a 1 mm, 12-wel l gel

GEL Purification Mini Kit (200prep)

FAGPK-001-1 200 preps
EUR 169

GEL/PCR Purification Mini Kit (300prep)

FAGCK-001-1 300 preps
EUR 172

mini tube gel insert

EUR 411

AE-6210-2 Slab Gel Cast

2392981 1unit
EUR 634

Mini gel tubes, 7 x 2.5 x 75 mm, 8/pk

2394122 6unit
EUR 263

Mini gel tubes, 7 x 2.5 x 100 mm, 8/pk

2394132 6unit
EUR 273


TGL-1140 250/pk
EUR 298
Description: Non Filter Tips; Pipette Tips - Axygen


TGL-1140-R 480/pk
EUR 407
Description: Non Filter Tips; Pipette Tips - Axygen


TGL-1165 250/pk
EUR 298
Description: Non Filter Tips; Pipette Tips - Axygen


TGL-1165-R 480/pk
EUR 407
Description: Non Filter Tips; Pipette Tips - Axygen

GEL Purification Mini Kit (50prep)

FAGPK-001 50 preps
EUR 120

GEL Purification Mini Kit (300prep)

FAGPK-001-2 300 preps
EUR 189

mini-wide tube gel insert

EUR 437

Mouse Calpastatin (CAST) ELISA Kit

EUR 527
  • Should the Mouse Calpastatin (CAST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Calpastatin (CAST) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Calpastatin (CAST) ELISA Kit

EUR 688
  • Should the Mouse Calpastatin (CAST) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Calpastatin (CAST) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Calpastatin (CAST) ELISA Kit

RD-CAST-Mu-48Tests 48 Tests
EUR 533

Mouse Calpastatin (CAST) ELISA Kit

RD-CAST-Mu-96Tests 96 Tests
EUR 740

Mouse Calpastatin (CAST) ELISA Kit

RDR-CAST-Mu-48Tests 48 Tests
EUR 557

Mouse Calpastatin (CAST) ELISA Kit

RDR-CAST-Mu-96Tests 96 Tests
EUR 774

mini capillary tubes 1 mm pk/100

EVS1100-TUBE-1.0 ea
EUR 65

GEL/PCR Purification Mini Kit (100prep)

FAGCK-001 100 preps
EUR 129

FastPure Gel DNA Extraction Mini Kit

DC301-01 100 rxn
EUR 129

Silica Gel, pore size ~25A, 1 - 3 mm beads

GX9287-1KG 1 kg
EUR 78

Silica Gel, pore size ~25A, 1 - 3 mm beads

GX9287-500G 500 g
EUR 58

Silica Gel, pore size ~25A, 1 - 3 mm beads

GX9287-5KG 5 kg
EUR 205

Prosi Silver Staining Kit for 25 mini gel

S3200-020 1kit
EUR 361

Cycloheximide (100 mM)

EUR 142

Dexamethasone (10 mM)

EUR 153


HGB10-12-1 1/pk
EUR 57
Description: Lab Equipment; Axygen Branded EQ


HGB10-16-1 1/pk
EUR 57
Description: Lab Equipment; Axygen Branded EQ


HGB10-25-1 1/pk
EUR 59
Description: Lab Equipment; Axygen Branded EQ


HGB10-8-1 1/pk
EUR 59
Description: Lab Equipment; Axygen Branded EQ


HGB15-10-1 1/pk
EUR 60
Description: Lab Equipment; Axygen Branded EQ


HGB15-12-1 1/pk
EUR 60
Description: Lab Equipment; Axygen Branded EQ


HGB15-16-1 1/pk
EUR 60
Description: Lab Equipment; Axygen Branded EQ


HGB15-20-1 1/pk
EUR 60
Description: Lab Equipment; Axygen Branded EQ


HGB15-8-1 1/pk
EUR 69
Description: Lab Equipment; Axygen Branded EQ


HGB20-25-1 1/pk
EUR 69
Description: Lab Equipment; Axygen Branded EQ


HGB20-30-1 1/pk
EUR 69
Description: Lab Equipment; Axygen Branded EQ


HGB7-10-1 1/pk
EUR 54
Description: Lab Equipment; Axygen Branded EQ


HGB7-16-1 1/pk
EUR 54
Description: Lab Equipment; Axygen Branded EQ


HGB7-8-1 1/pk
EUR 54
Description: Lab Equipment; Axygen Branded EQ

mini capillary tubes 1.5 mm pk/100

EVS1100-TUBE-1.5 ea
EUR 65

SYBR Safe DNA Gel Stain

A8743-1 1 ml
EUR 161


21001-1 1L
EUR 226
Description: Minimum order quantity: 1 unit of 1L


21002-1 10ML
EUR 178
Description: Minimum order quantity: 1 unit of 10ML

Hi-Bind? T-Gel-Agarose

EUR 131

Silica Gel, pore size ~25A, 2 - 5 mm beads

GX6254-1KG 1 kg
EUR 78

Silica Gel, pore size ~25A, 2 - 5 mm beads

GX6254-500G 500 g
EUR 58

Silica Gel, pore size ~25A, 2 - 5 mm beads

GX6254-5KG 5 kg
EUR 205

WSE-1165 Mini-Slab 1set (Gel casting kit included)

2322198 1unit
EUR 797
Description: WSE-1165 Built in Power Supply Type (2322198/2321650/2321659). El ect r ophor esi s chamber , Bui l t i n power suppl y, gel cast i ng k i t

T-Pro Gel/PCR DNA Purification Mini Kit (100)

RB94-NES100 100preps/Kit
EUR 161

T-Pro Gel/PCR DNA Purification Mini Kit (250)

RB94-NES250 250preps/Kit
EUR 222

Cast/ Rat Cast ELISA Kit

ELI-03954r 96 Tests
EUR 886

MicroElute GEL Purification Kit (200prep)

FAMGK-001-1 200 preps
EUR 187


HGB10-10MC-1 1/pk
EUR 56
Description: Lab Equipment; Axygen Branded EQ


HGB10-20MC-1 1/pk
EUR 59
Description: Lab Equipment; Axygen Branded EQ


HGB15-14MC-1 1/pk
EUR 63
Description: Lab Equipment; Axygen Branded EQ


HGB15-16MC-1 1/pk
EUR 60
Description: Lab Equipment; Axygen Branded EQ


HGB15-18MC-1 1/pk
EUR 60
Description: Lab Equipment; Axygen Branded EQ


HGB15-28MC-1 1/pk
EUR 62
Description: Lab Equipment; Axygen Branded EQ


HGB15-30MC-1 1/pk
EUR 62
Description: Lab Equipment; Axygen Branded EQ


HGB20-20MC-1 1/pk
EUR 69
Description: Lab Equipment; Axygen Branded EQ


HGB20-40MC-1 1/pk
EUR 69
Description: Lab Equipment; Axygen Branded EQ


HGB7-12MC-1 1/pk
EUR 54
Description: Lab Equipment; Axygen Branded EQ

pCDH-CuO-MCS-EF1-GFP+Puro dual promoter and dual marker lentivector

QM513B-1 10 ug
EUR 679
  • Category: Lentiviral Technology

Dual- Color AP Staining Kit

AP100D-1 100 Assays
EUR 412
  • Category: Stem Cells

Single channel mini-pipette (130 mm) 10 ul, autoclavable

SCMP-10 1
EUR 92

Single channel mini-pipette (130 mm) 100 ul, autoclavable

SCMP-100 1
EUR 92

Single channel mini-pipette (130 mm) 20 ul, autoclavable

SCMP-20 1
EUR 92

Single channel mini-pipette (130 mm) 25 ul, autoclavable

SCMP-25 1
EUR 92

Single channel mini-pipette (130 mm) 5 ul, autoclavable

SCMP-5 1
EUR 92

Single channel mini-pipette (130 mm) 50 ul, autoclavable

SCMP-50 1
EUR 92


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAST Antibody

36300-100ul 100ul
EUR 252

CAST antibody

70R-16186 50 ul
EUR 435
Description: Rabbit polyclonal CAST antibody

CAST Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAST Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:10-1:500, IF:1:50-1:200

CAST Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

CAST Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200


YF-PA27184 50 ug
EUR 363
Description: Mouse polyclonal to CAST

Maximo-Gel juice fluorescent Protein-Gel Gel stain

310012 10 ml
EUR 185

Maximo-Gel juice fluorescent Protein-Gel Gel stain

310012-L 10x10ml
EUR 1587

MicroElute GEL/PCR Purification Kit (200prep)

FAEPK-001-1 200 preps
EUR 208

Silica Gel, self-indicating, blue to pink, 2 - 5 mm beads

GE5162-1KG 1 kg
EUR 89

Silica Gel, self-indicating, blue to pink, 2 - 5 mm beads

GE5162-500G 500 g
EUR 64

Silica Gel, self-indicating, blue to pink, 2 - 5 mm beads

GE5162-5KG 5 kg
EUR 245

Anti-Creatine Kinase MM/CKM Antibody

A03452-1 100ug/vial
EUR 334

Gel-Bright LED Gel Illuminator

E90003 1EA
EUR 773
Description: Minimum order quantity: 1 unit of 1EA

Gel-FAST? Gel Staining/Destaining Kit

EUR 175

Gel Tray

2394250 4unit
EUR 270
Description: I ncl udi ng pl at es

Gel Tray

2398194 2unit
EUR 354

TC Gel

CP048-005 500 g
EUR 232

TC Gel

CP048-010 1 Kg
EUR 347

Gel Cutter

KS071012-11 12
EUR 89
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

Gel Filter

KS071012-13 12
EUR 115
Description: Premade ready to use kits will always come in handy. Get your experiment done right form the first try by using a validated kit with perfectly balanced reagents proportions and compatibility and by following a clear protocol.

CAST Conjugated Antibody

C34652 100ul
EUR 397

CAST Conjugated Antibody

C36300 100ul
EUR 397

CAST cloning plasmid

CSB-CL004561HU-10ug 10ug
EUR 671
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2004
  • Sequence: atgaatcccacagaaaccaaggctgtaaaaacagaacctgagaagaagtcacagtcaaccaagccaaaaagcctacccaagcaggcatcagatacaggaagtaacgatgctcacaataaaaaagcagtttccagatcagctgaacagcagccatcagagaaatcaacagaaccaa
  • Show more
Description: A cloning plasmid for the CAST gene.

Calpastatin (CAST) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpastatin (CAST) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpastatin (CAST) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

abx231220-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CAST Rabbit pAb

A0097-100ul 100 ul
EUR 308

CAST Rabbit pAb

A0097-200ul 200 ul
EUR 459

CAST Rabbit pAb

A0097-20ul 20 ul
EUR 183

CAST Rabbit pAb

A0097-50ul 50 ul
EUR 223

CAST Polyclonal Antibody

A54656 100 µg
EUR 570.55
Description: The best epigenetics products

CAST Rabbit pAb

A13683-100ul 100 ul
EUR 308

CAST Rabbit pAb

A13683-200ul 200 ul
EUR 459

CAST Rabbit pAb

A13683-20ul 20 ul
EUR 183

CAST Rabbit pAb

A13683-50ul 50 ul
EUR 223

CAST Rabbit pAb

A16789-100ul 100 ul
EUR 308

CAST Rabbit pAb

A16789-200ul 200 ul
EUR 459

CAST Rabbit pAb

A16789-20ul 20 ul
EUR 183

CAST Rabbit pAb

A16789-50ul 50 ul
EUR 223

CAST Rabbit pAb

A16790-100ul 100 ul
EUR 308

CAST Rabbit pAb

A16790-200ul 200 ul
EUR 459

CAST Rabbit pAb

A16790-20ul 20 ul
EUR 183

CAST Rabbit pAb

A16790-50ul 50 ul
EUR 223

Human Calpastatin (CAST)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calpastatin(CAST) expressed in Yeast

Human Calpastatin (CAST)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 75.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calpastatin(CAST) expressed in E.coli


PVT13136 2 ug
EUR 391

Anti-CAST antibody

STJ29949 100 µl
EUR 413
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-CAST antibody

STJ22910 100 µl
EUR 277
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-CAST antibody

STJ119189 100 µl
EUR 277

Anti-CAST antibody

STJ119190 100 µl
EUR 277

Anti-CAST antibody

STJ115638 100 µl
EUR 277
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Lipopolysaccharides (LPS) from E. coli (strain O26:B6) gel purified

LPS16-1 1 mg
EUR 225

Lipopolysaccharides (LPS) from E. coli (strain O55:B5) gel purified

LPS17-1 1 mg
EUR 225

pCDH-CuO-MCS-EF1-GFP dual promoter lentivector

QM511B-1 10 ug
EUR 679
  • Category: Lentiviral Technology

pCDH-CuO-MCS-EF1-RFP dual promoter lentivector

QM512B-1 10 ug
EUR 679
  • Category: Lentiviral Technology

Silica Gel, self-indicating, orange to colourless, 4 - 8 mm beads, cobalt free

GE9411-1KG 1 kg
EUR 91

Silica Gel, self-indicating, orange to colourless, 4 - 8 mm beads, cobalt free

GE9411-500G 500 g
EUR 66

Fungi/ Yeast Genomic DNA Extraction Mini Kit(100prep)

FAFYG001-1 100 preps
EUR 390

1 mm Dual Mini Gel Cast