Goat Peste des Petits Ruminants Virus 

To Order Contact us: stephen@expresspharmapulse.com

Peste des petits ruminants virus RT PCR kit

RTq-V318-100R 100T
EUR 776.4
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Peste des petits ruminants virus .

Peste des petits ruminants virus RT PCR kit

RTq-V318-150R 150T
EUR 877.9
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Peste des petits ruminants virus .

Peste des petits ruminants virus RT PCR kit

RTq-V318-50R 50T
EUR 631.4
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Peste des petits ruminants virus .

Goat Peste des Petits Ruminants (PPR) ELISA Kit

abx055656-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Peste des Petits Ruminants Virus Antibody Rapid Test Kit

abx092068-50tests 50 tests
EUR 356
  • Shipped within 5-12 working days.

Peste des petits ruminants virus One-Step PCR kit

Oneq-V318-100R 100T
EUR 933
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Peste des petits ruminants virus.

Peste des petits ruminants virus One-Step PCR kit

Oneq-V318-150R 150T
EUR 1060.6
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Peste des petits ruminants virus.

Peste des petits ruminants virus One-Step PCR kit

Oneq-V318-50R 50T
EUR 751.75
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Peste des petits ruminants virus.

Goat Peste des Petits Ruminants Virus Antibody (PPRV-Ab) ELISA Kit

abx364806-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Peste des Petits Ruminants?PPR ELISA Kit

201-12-2004 96 tests
EUR 440
  • This Peste des Petits Ruminants?PPR ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Peste des Petits Ruminants(PPR)ELISA Kit

QY-E00851 96T
EUR 361

Peste des Petits Ruminants Virus Antibodies Rapid Test Kit (Colloidal gold)

abx092018-50tests 50 tests
EUR 488
  • Shipped within 5-12 working days.

Rabbit Anti-Peste des petits ruminants (PPR) protein antiserum

PPR11-S 100 ul
EUR 457

ELISA kit for Goat Peste Des Petits Ruminants IgG (PPR IgG)  Kit

KTE50042-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Goat Peste Des Petits Ruminants IgG (PPR IgG)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Peste Des Petits Ruminants IgG (PPR IgG)  Kit

KTE50042-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Goat Peste Des Petits Ruminants IgG (PPR IgG)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Peste Des Petits Ruminants IgG (PPR IgG)  Kit

KTE50042-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Goat Peste Des Petits Ruminants IgG (PPR IgG)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant Peste des petits ruminants (PPR) control for western blot

PPR11-C 100 ul
EUR 286

Goat Anti-Peste des petits ruminants NP IgG (PPR-NP) negative control serum

RV-400805-01N 1 ml
EUR 164

Goat/Sheep Anti-Peste des petits ruminants NP IgG (PPR-NP) positive control serum

RV-400805-02P 1 ml
EUR 225

Camel Anti-Peste des petits ruminants NP (PPR-NP) IgG negative control serum

RV-400820-05N 1 ml Ask for price

Recombinant (E.coli) Peste des petits ruminants (PPR) protein (>95%, his-tag, 58 kDa) purified

PPR15-R-10 10 ug
EUR 347

Recombivirus? Camel Anti-Peste des petits ruminants NP (PPR-NP) IgG positive control serum

RV-400820-06P 1 ml Ask for price

Recombivirus? Camel Anti-Peste des petits ruminants NP IgG (PPR-NP) ELISA kit, Quantitative, 1x96 tests

RV-400820-1 1 kit
EUR 712

Recombivirus? Camel Anti-Peste des petits ruminants NP IgG (PPR-NP) ELISA kit, Quantitative, 5x96 tests

RV-400820-5 1 kit
EUR 2425

Peste des petits ruminants NP (PPR-NP) peptide 421-455 aa, >90% pure (specific for PPR protein) (corresponding rinder pest peptide #RPR17-P)

PPR15-P 1 mg
EUR 286

Peste des petits ruminants NP (PPR-NP) peptide 456-490 aa, >90% pure (specific for PPR protein) (corresponding rinder pest peptide #RPR18-P)

PPR16-P 1 mg
EUR 286

Human Desmin (Des) ELISA Kit

DLR-Des-Hu-48T 48T
EUR 479
  • Should the Human Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Desmin (Des) ELISA Kit

DLR-Des-Hu-96T 96T
EUR 621
  • Should the Human Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Desmin (Des) ELISA Kit

DLR-Des-Mu-48T 48T
EUR 489
  • Should the Mouse Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Desmin (Des) in samples from tissue homogenates or other biological fluids.

Mouse Desmin (Des) ELISA Kit

DLR-Des-Mu-96T 96T
EUR 635
  • Should the Mouse Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Desmin (Des) in samples from tissue homogenates or other biological fluids.

Rat Desmin (Des) ELISA Kit

DLR-Des-Ra-48T 48T
EUR 508
  • Should the Rat Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Desmin (Des) ELISA Kit

DLR-Des-Ra-96T 96T
EUR 661
  • Should the Rat Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Desmin (Des) ELISA Kit

RDR-Des-Hu-48Tests 48 Tests
EUR 500

Human Desmin (Des) ELISA Kit

RDR-Des-Hu-96Tests 96 Tests
EUR 692

Mouse Desmin (Des) ELISA Kit

RDR-Des-Mu-48Tests 48 Tests
EUR 511

Mouse Desmin (Des) ELISA Kit

RDR-Des-Mu-96Tests 96 Tests
EUR 709

Rat Desmin (Des) ELISA Kit

RDR-Des-Ra-48Tests 48 Tests
EUR 534

Rat Desmin (Des) ELISA Kit

RDR-Des-Ra-96Tests 96 Tests
EUR 742

Human Desmin (Des) ELISA Kit

RD-Des-Hu-48Tests 48 Tests
EUR 478

Human Desmin (Des) ELISA Kit

RD-Des-Hu-96Tests 96 Tests
EUR 662

Mouse Desmin (Des) ELISA Kit

RD-Des-Mu-48Tests 48 Tests
EUR 489

Mouse Desmin (Des) ELISA Kit

RD-Des-Mu-96Tests 96 Tests
EUR 677

Rat Desmin (Des) ELISA Kit

RD-Des-Ra-48Tests 48 Tests
EUR 511

Rat Desmin (Des) ELISA Kit

RD-Des-Ra-96Tests 96 Tests
EUR 709

Goat Des ELISA Kit

EGTD0165 96Tests
EUR 521

Goat Desmin(DES) ELISA kit

E06D0282-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Desmin(DES) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Desmin(DES) ELISA kit

E06D0282-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Desmin(DES) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Desmin(DES) ELISA kit

E06D0282-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Desmin(DES) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat anti desmin (DES) antibody ELISA kit

E06A2062-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat anti desmin (DES) antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat anti desmin (DES) antibody ELISA kit

E06A2062-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat anti desmin (DES) antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat anti desmin (DES) antibody ELISA kit

E06A2062-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat anti desmin (DES) antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Des-Gamma-carboxy-prothrombin ELISA kit

E06D0326-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Des-Gamma-carboxy-prothrombin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Des-Gamma-carboxy-prothrombin ELISA kit

E06D0326-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Des-Gamma-carboxy-prothrombin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Des-Gamma-carboxy-prothrombin ELISA kit

E06D0326-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Des-Gamma-carboxy-prothrombin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Des/ Rat Des ELISA Kit

ELA-E0373r 96 Tests
EUR 886

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

EUR 554
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

EUR 725
  • Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RD-GOAT-Hu-48Tests 48 Tests
EUR 563

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RD-GOAT-Hu-96Tests 96 Tests
EUR 783

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RDR-GOAT-Hu-48Tests 48 Tests
EUR 589

Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit

RDR-GOAT-Hu-96Tests 96 Tests
EUR 820

Goat pox virus PCR kit

PCR-V310-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Goat pox virus

Goat pox virus PCR kit

PCR-V310-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Goat pox virus


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DES Antibody

ABD6138 100 ug
EUR 438

DES antibody

38152-100ul 100ul
EUR 252

DES Antibody

43938-100ul 100ul
EUR 252

DES antibody

70R-16804 50 ul
EUR 435
Description: Rabbit polyclonal DES antibody

DES Antibody

DF6138 200ul
EUR 304
Description: DES Antibody detects endogenous levels of total DES.

DES Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DES. Recognizes DES from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

DES Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DES. Recognizes DES from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

DES Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DES. Recognizes DES from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DES Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DES. Recognizes DES from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

[Des-Arg30, Des-Pro31]-Dendroaspis Natriuretic Peptide

5-00163 4 x 1mg Ask for price

Goat Pox Virus (Goatpox) ELISA Kit

abx055279-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Goat polyclonal antibody for Rubella virus

504 1 ml
EUR 311
Description: This is HRP conjugated goat polyclonal antibody against Rubella virus virions for WB, ELISA.

Goat polyclonal antibody for Rubella virus

1701 1 ml
EUR 272.94
Description: This is goat polyclonal antibody against Rubella virus virions for WB, ELISA.

Goat polyclonal antibody for Rubella virus

1703 1 ml
EUR 289.25
Description: This is FITC conjugated goat polyclonal antibody against Rubella virus virions for WB, ELISA.

Goat polyclonal antibody for Rubella virus

1707 1 ml
EUR 289.25
Description: This is Biotin conjugated goat polyclonal antibody against Rubella virus virions for WB, ELISA.

Goat pox virus RT PCR kit

RTq-V310-100D 100T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Goat pox virus .

Goat pox virus RT PCR kit

RTq-V310-150D 150T
EUR 701
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Goat pox virus .

Goat pox virus RT PCR kit

RTq-V310-50D 50T
EUR 532.8
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Goat pox virus .

DES Conjugated Antibody

C38152 100ul
EUR 397

DES Conjugated Antibody

C43938 100ul
EUR 397

DES cloning plasmid

CSB-CL006735HU-10ug 10ug
EUR 506
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgagccaggcctactcgtccagccagcgcgtgtcctcctaccgccgcaccttcggcggggccccgggcttcccgctcggctccccgctgagctcgcccgtgttcccgcgggcgggtttcggctctaagggctcctccagctcggtgacgtcccgcgtgtaccaggtgtcgcgca
  • Show more
Description: A cloning plasmid for the DES gene.


H-5535.0500 0.5mg
EUR 212
Description: Sum Formula: C66H108N22O21; CAS# [94245-80-4]


H-5535.1000 1.0mg
EUR 334
Description: Sum Formula: C66H108N22O21; CAS# [94245-80-4]


H-6156.0500 0.5mg
EUR 334
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-27-8] net


H-6156.1000 1.0mg
EUR 576
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-27-8] net


H-6158.0500 0.5mg
EUR 334
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-28-9] net


H-6158.1000 1.0mg
EUR 576
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-28-9] net


H-7486.0100 0.1mg
EUR 119
Description: Sum Formula: C182H279N49O59S; CAS# [1678416-78-8] net


H-7486.0500 0.5mg
EUR 371
Description: Sum Formula: C182H279N49O59S; CAS# [1678416-78-8] net


H-7486.1000 1.0mg
EUR 612
Description: Sum Formula: C182H279N49O59S; CAS# [1678416-78-8] net


H-7538.0500 0.5mg
EUR 441
Description: Sum Formula: C199H314N62O60S5; CAS# [1816939-38-4] net


H-7538.1000 1.0mg
EUR 793
Description: Sum Formula: C199H314N62O60S5; CAS# [1816939-38-4] net


H-9200.0005 5.0mg
EUR 297
Description: Sum Formula: C50H70N16O11; CAS# [38280-53-4]


H-9200.0025 25.0mg
EUR 1093
Description: Sum Formula: C50H70N16O11; CAS# [38280-53-4]


H-1965.0025 25.0mg
EUR 321
Description: Sum Formula: C44H61N11O10; CAS# [15958-92-6]


H-1965.0100 100.0mg
EUR 902
Description: Sum Formula: C44H61N11O10; CAS# [15958-92-6]


HY-P0298 10mg
EUR 160

Desmin (DES) Antibody

  • EUR 592.00
  • EUR 857.00
  • EUR 217.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx122581-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmin (Des) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Desmin (DES) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx010636-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx031687-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx031687-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx027938-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx027938-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx020549-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Desmin (Des) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Desmin (Des) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Desmin (Des) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Desmin (Des) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Desmin (Des) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Desmin (DES) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx431203-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Desmin (DES) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Desmin (DES) Antibody

abx232340-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Desmin (DES) Antibody

abx232341-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Desmin (DES) Antibody

abx232342-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

DES Rabbit pAb

A0356-100ul 100 ul
EUR 308

DES Rabbit pAb

A0356-200ul 200 ul
EUR 459

DES Rabbit pAb

A0356-20ul 20 ul Ask for price

DES Rabbit pAb

A0356-50ul 50 ul Ask for price

DES Rabbit pAb

A10838-100ul 100 ul
EUR 459

DES Rabbit pAb

A10838-200ul 200 ul
EUR 686

DES Rabbit pAb

A10838-20ul 20 ul
EUR 183

Goat Peste des Petits Ruminants Virus