Goat Peste des Petits Ruminants Virus
To Order Contact us: stephen@expresspharmapulse.com
Peste des petits ruminants virus RT PCR kit |
RTq-V318-100R |
Bioingentech |
100T |
EUR 776.4 |
- Contact us in order to know the reactivity of the kit.
|
Description: A Real-Time PCR kit for detection of Peste des petits ruminants virus . |
Peste des petits ruminants virus RT PCR kit |
RTq-V318-150R |
Bioingentech |
150T |
EUR 877.9 |
- Contact us in order to know the reactivity of the kit.
|
Description: A Real-Time PCR kit for detection of Peste des petits ruminants virus . |
Peste des petits ruminants virus RT PCR kit |
RTq-V318-50R |
Bioingentech |
50T |
EUR 631.4 |
- Contact us in order to know the reactivity of the kit.
|
Description: A Real-Time PCR kit for detection of Peste des petits ruminants virus . |
Goat Peste des Petits Ruminants (PPR) ELISA Kit |
abx055656-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-10 working days.
|
Peste des Petits Ruminants Virus Antibody Rapid Test Kit |
abx092068-50tests |
Abbexa |
50 tests |
EUR 356 |
- Shipped within 5-12 working days.
|
Peste des petits ruminants virus One-Step PCR kit |
Oneq-V318-100R |
Bioingentech |
100T |
EUR 933 |
- Contact us in order to know the reactivity of the kit.
|
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Peste des petits ruminants virus. |
Peste des petits ruminants virus One-Step PCR kit |
Oneq-V318-150R |
Bioingentech |
150T |
EUR 1060.6 |
- Contact us in order to know the reactivity of the kit.
|
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Peste des petits ruminants virus. |
Peste des petits ruminants virus One-Step PCR kit |
Oneq-V318-50R |
Bioingentech |
50T |
EUR 751.75 |
- Contact us in order to know the reactivity of the kit.
|
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Peste des petits ruminants virus. |
Goat Peste des Petits Ruminants Virus Antibody (PPRV-Ab) ELISA Kit |
abx364806-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human Peste des Petits Ruminants?PPR ELISA Kit |
201-12-2004 |
SunredBio |
96 tests |
EUR 440 |
- This Peste des Petits Ruminants?PPR ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Peste des Petits Ruminants Virus Antibodies Rapid Test Kit (Colloidal gold) |
abx092018-50tests |
Abbexa |
50 tests |
EUR 488 |
- Shipped within 5-12 working days.
|
Rabbit Anti-Peste des petits ruminants (PPR) protein antiserum |
PPR11-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
ELISA kit for Goat Peste Des Petits Ruminants IgG (PPR IgG) Kit |
KTE50042-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Goat Peste Des Petits Ruminants IgG (PPR IgG) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Goat Peste Des Petits Ruminants IgG (PPR IgG) Kit |
KTE50042-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Goat Peste Des Petits Ruminants IgG (PPR IgG) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Goat Peste Des Petits Ruminants IgG (PPR IgG) Kit |
KTE50042-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Goat Peste Des Petits Ruminants IgG (PPR IgG) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Recombinant Peste des petits ruminants (PPR) control for western blot |
PPR11-C |
Alpha Diagnostics |
100 ul |
EUR 286 |
Goat Anti-Peste des petits ruminants NP IgG (PPR-NP) negative control serum |
RV-400805-01N |
Alpha Diagnostics |
1 ml |
EUR 164 |
Goat/Sheep Anti-Peste des petits ruminants NP IgG (PPR-NP) positive control serum |
RV-400805-02P |
Alpha Diagnostics |
1 ml |
EUR 225 |
Camel Anti-Peste des petits ruminants NP (PPR-NP) IgG negative control serum |
RV-400820-05N |
Alpha Diagnostics |
1 ml |
Ask for price |
Recombinant (E.coli) Peste des petits ruminants (PPR) protein (>95%, his-tag, 58 kDa) purified |
PPR15-R-10 |
Alpha Diagnostics |
10 ug |
EUR 347 |
Recombivirus? Camel Anti-Peste des petits ruminants NP (PPR-NP) IgG positive control serum |
RV-400820-06P |
Alpha Diagnostics |
1 ml |
Ask for price |
Recombivirus? Camel Anti-Peste des petits ruminants NP IgG (PPR-NP) ELISA kit, Quantitative, 1x96 tests |
RV-400820-1 |
Alpha Diagnostics |
1 kit |
EUR 712 |
Recombivirus? Camel Anti-Peste des petits ruminants NP IgG (PPR-NP) ELISA kit, Quantitative, 5x96 tests |
RV-400820-5 |
Alpha Diagnostics |
1 kit |
EUR 2425 |
Peste des petits ruminants NP (PPR-NP) peptide 421-455 aa, >90% pure (specific for PPR protein) (corresponding rinder pest peptide #RPR17-P) |
PPR15-P |
Alpha Diagnostics |
1 mg |
EUR 286 |
Peste des petits ruminants NP (PPR-NP) peptide 456-490 aa, >90% pure (specific for PPR protein) (corresponding rinder pest peptide #RPR18-P) |
PPR16-P |
Alpha Diagnostics |
1 mg |
EUR 286 |
Human Desmin (Des) ELISA Kit |
DLR-Des-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Desmin (Des) ELISA Kit |
DLR-Des-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Desmin (Des) ELISA Kit |
DLR-Des-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Desmin (Des) in samples from tissue homogenates or other biological fluids. |
Mouse Desmin (Des) ELISA Kit |
DLR-Des-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Desmin (Des) in samples from tissue homogenates or other biological fluids. |
Rat Desmin (Des) ELISA Kit |
DLR-Des-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Desmin (Des) ELISA Kit |
DLR-Des-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Desmin (Des) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Desmin (Des) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Desmin (Des) ELISA Kit |
RDR-Des-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Desmin (Des) ELISA Kit |
RDR-Des-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Desmin (Des) ELISA Kit |
RDR-Des-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Desmin (Des) ELISA Kit |
RDR-Des-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Desmin (Des) ELISA Kit |
RDR-Des-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Desmin (Des) ELISA Kit |
RDR-Des-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Desmin (Des) ELISA Kit |
RD-Des-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Desmin (Des) ELISA Kit |
RD-Des-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Desmin (Des) ELISA Kit |
RD-Des-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Desmin (Des) ELISA Kit |
RD-Des-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Desmin (Des) ELISA Kit |
RD-Des-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Desmin (Des) ELISA Kit |
RD-Des-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Goat Des ELISA Kit |
EGTD0165 |
Abclonal |
96Tests |
EUR 521 |
Goat Desmin(DES) ELISA kit |
E06D0282-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Desmin(DES) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Desmin(DES) ELISA kit |
E06D0282-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Desmin(DES) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Desmin(DES) ELISA kit |
E06D0282-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Desmin(DES) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat anti desmin (DES) antibody ELISA kit |
E06A2062-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat anti desmin (DES) antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat anti desmin (DES) antibody ELISA kit |
E06A2062-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat anti desmin (DES) antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat anti desmin (DES) antibody ELISA kit |
E06A2062-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat anti desmin (DES) antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Des-Gamma-carboxy-prothrombin ELISA kit |
E06D0326-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Des-Gamma-carboxy-prothrombin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Des-Gamma-carboxy-prothrombin ELISA kit |
E06D0326-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Des-Gamma-carboxy-prothrombin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Des-Gamma-carboxy-prothrombin ELISA kit |
E06D0326-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Des-Gamma-carboxy-prothrombin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
DLR-GOAT-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
DLR-GOAT-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Ghrelin-O-Acyltransferase (GOAT) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RD-GOAT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RD-GOAT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RDR-GOAT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit |
RDR-GOAT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Goat pox virus PCR kit |
PCR-V310-48D |
Bioingentech |
50T |
EUR 425.8 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Goat pox virus |
Goat pox virus PCR kit |
PCR-V310-96D |
Bioingentech |
100T |
EUR 521.5 |
- Contact us in order to know the reactivity of the kit.
|
Description: An conventional PCR kit for detection of Goat pox virus |
DES siRNA |
20-abx901475 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DES siRNA |
20-abx914030 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DES siRNA |
20-abx914031 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DES antibody |
38152-100ul |
SAB |
100ul |
EUR 252 |
DES Antibody |
43938-100ul |
SAB |
100ul |
EUR 252 |
DES antibody |
70R-16804 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DES antibody |
DES Antibody |
DF6138 |
Affbiotech |
200ul |
EUR 304 |
Description: DES Antibody detects endogenous levels of total DES. |
DES Antibody |
1-CSB-PA002116 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DES. Recognizes DES from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
DES Antibody |
1-CSB-PA002117 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DES. Recognizes DES from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
DES Antibody |
1-CSB-PA006735GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against DES. Recognizes DES from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
DES Antibody |
1-CSB-PA13149A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DES. Recognizes DES from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
[Des-Arg30, Des-Pro31]-Dendroaspis Natriuretic Peptide |
5-00163 |
CHI Scientific |
4 x 1mg |
Ask for price |
Goat Pox Virus (Goatpox) ELISA Kit |
abx055279-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-10 working days.
|
Goat polyclonal antibody for Rubella virus |
504 |
Virostat |
1 ml |
EUR 311 |
Description: This is HRP conjugated goat polyclonal antibody against Rubella virus virions for WB, ELISA. |
Goat polyclonal antibody for Rubella virus |
1701 |
Virostat |
1 ml |
EUR 272.94 |
Description: This is goat polyclonal antibody against Rubella virus virions for WB, ELISA. |
Goat polyclonal antibody for Rubella virus |
1703 |
Virostat |
1 ml |
EUR 289.25 |
Description: This is FITC conjugated goat polyclonal antibody against Rubella virus virions for WB, ELISA. |
Goat polyclonal antibody for Rubella virus |
1707 |
Virostat |
1 ml |
EUR 289.25 |
Description: This is Biotin conjugated goat polyclonal antibody against Rubella virus virions for WB, ELISA. |
Goat pox virus RT PCR kit |
RTq-V310-100D |
Bioingentech |
100T |
EUR 628.5 |
- Contact us in order to know the reactivity of the kit.
|
Description: A Real-Time PCR kit for detection of Goat pox virus . |
Goat pox virus RT PCR kit |
RTq-V310-150D |
Bioingentech |
150T |
EUR 701 |
- Contact us in order to know the reactivity of the kit.
|
Description: A Real-Time PCR kit for detection of Goat pox virus . |
Goat pox virus RT PCR kit |
RTq-V310-50D |
Bioingentech |
50T |
EUR 532.8 |
- Contact us in order to know the reactivity of the kit.
|
Description: A Real-Time PCR kit for detection of Goat pox virus . |
DES Conjugated Antibody |
C38152 |
SAB |
100ul |
EUR 397 |
DES Conjugated Antibody |
C43938 |
SAB |
100ul |
EUR 397 |
DES cloning plasmid |
CSB-CL006735HU-10ug |
Cusabio |
10ug |
EUR 506 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1413
- Sequence: atgagccaggcctactcgtccagccagcgcgtgtcctcctaccgccgcaccttcggcggggccccgggcttcccgctcggctccccgctgagctcgcccgtgttcccgcgggcgggtttcggctctaagggctcctccagctcggtgacgtcccgcgtgtaccaggtgtcgcgca
- Show more
|
Description: A cloning plasmid for the DES gene. |
(Des-Ser1)-Cerebellin |
H-5535.0500 |
Bachem |
0.5mg |
EUR 212 |
Description: Sum Formula: C66H108N22O21; CAS# [94245-80-4] |
(Des-Ser1)-Cerebellin |
H-5535.1000 |
Bachem |
1.0mg |
EUR 334 |
Description: Sum Formula: C66H108N22O21; CAS# [94245-80-4] |
(Des-Thr5)-Glucagon |
H-6156.0500 |
Bachem |
0.5mg |
EUR 334 |
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-27-8] net |
(Des-Thr5)-Glucagon |
H-6156.1000 |
Bachem |
1.0mg |
EUR 576 |
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-27-8] net |
(Des-Thr7)-Glucagon |
H-6158.0500 |
Bachem |
0.5mg |
EUR 334 |
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-28-9] net |
(Des-Thr7)-Glucagon |
H-6158.1000 |
Bachem |
1.0mg |
EUR 576 |
Description: Sum Formula: C149H218N42O47S; CAS# [1802078-28-9] net |
(Des-Gly2)-Exenatide |
H-7486.0100 |
Bachem |
0.1mg |
EUR 119 |
Description: Sum Formula: C182H279N49O59S; CAS# [1678416-78-8] net |
(Des-Gly2)-Exenatide |
H-7486.0500 |
Bachem |
0.5mg |
EUR 371 |
Description: Sum Formula: C182H279N49O59S; CAS# [1678416-78-8] net |
(Des-Gly2)-Exenatide |
H-7486.1000 |
Bachem |
1.0mg |
EUR 612 |
Description: Sum Formula: C182H279N49O59S; CAS# [1678416-78-8] net |
(Des-Lys38)-M65 |
H-7538.0500 |
Bachem |
0.5mg |
EUR 441 |
Description: Sum Formula: C199H314N62O60S5; CAS# [1816939-38-4] net |
(Des-Lys38)-M65 |
H-7538.1000 |
Bachem |
1.0mg |
EUR 793 |
Description: Sum Formula: C199H314N62O60S5; CAS# [1816939-38-4] net |
(Des-Pyr1)-LHRH |
H-9200.0005 |
Bachem |
5.0mg |
EUR 297 |
Description: Sum Formula: C50H70N16O11; CAS# [38280-53-4] |
(Des-Pyr1)-LHRH |
H-9200.0025 |
Bachem |
25.0mg |
EUR 1093 |
Description: Sum Formula: C50H70N16O11; CAS# [38280-53-4] |
(Des-Arg9)-Bradykinin |
H-1965.0025 |
Bachem |
25.0mg |
EUR 321 |
Description: Sum Formula: C44H61N11O10; CAS# [15958-92-6] |
(Des-Arg9)-Bradykinin |
H-1965.0100 |
Bachem |
100.0mg |
EUR 902 |
Description: Sum Formula: C44H61N11O10; CAS# [15958-92-6] |
Desmin (DES) Antibody |
20-abx125113 |
Abbexa |
-
EUR 592.00
-
EUR 857.00
-
EUR 217.00
-
EUR 411.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
20-abx125323 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
20-abx112046 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx122581-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
20-abx000692 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
20-abx000834 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
20-abx159470 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Desmin (Des) Antibody |
20-abx100036 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Desmin (DES) Antibody |
20-abx009339 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx010636-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
20-abx013058 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx031687-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx031687-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx027938-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx027938-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx020549-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Desmin (Des) Antibody |
20-abx172093 |
Abbexa |
|
|
|
Desmin (Des) Antibody |
20-abx172094 |
Abbexa |
|
|
|
Desmin (Des) Antibody |
20-abx176149 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Desmin (Des) Antibody |
20-abx176150 |
Abbexa |
|
|
|
Desmin (Des) Antibody |
20-abx176151 |
Abbexa |
|
|
|
Desmin (DES) Antibody |
20-abx328474 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
20-abx329232 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx431203-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Desmin (DES) Antibody |
20-abx302193 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Desmin (DES) Antibody |
abx232340-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Desmin (DES) Antibody |
abx232341-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Desmin (DES) Antibody |
abx232342-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
DES Rabbit pAb |
A0356-100ul |
Abclonal |
100 ul |
EUR 308 |
DES Rabbit pAb |
A0356-200ul |
Abclonal |
200 ul |
EUR 459 |
DES Rabbit pAb |
A0356-20ul |
Abclonal |
20 ul |
Ask for price |
DES Rabbit pAb |
A0356-50ul |
Abclonal |
50 ul |
Ask for price |
DES Rabbit pAb |
A10838-100ul |
Abclonal |
100 ul |
EUR 459 |
DES Rabbit pAb |
A10838-200ul |
Abclonal |
200 ul |
EUR 686 |
DES Rabbit pAb |
A10838-20ul |
Abclonal |
20 ul |
EUR 183 |
Goat Peste des Petits Ruminants Virus