Anti-ASAP1 antibody 

To Order Contact us: stephen@expresspharmapulse.com

Anti-ASAP1 (1B5)

YF-MA18363 100 ug
EUR 363
Description: Mouse monoclonal to ASAP1

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-Phospho-ASAP1 Y782 Antibody

P03848 100ug
EUR 432
Description: Rabbit Polyclonal Phospho-ASAP1 Y782 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

ASAP1 antibody

ABD8746 100 ug
EUR 438

ASAP1 antibody

10-2474 250 ug
EUR 492
Description: Mouse monoclonal ASAP1 antibody

ASAP1

45464-100ul 100ul
EUR 252

ASAP1

45464-50ul 50ul
EUR 187

ASAP1

DF8746 200ul
EUR 304
Description: ASAP1detects endogenous levels of total ASAP1.

ASAP1 Conjugated Antibody

C45464 100ul
EUR 397

ASAP1 siRNA

20-abx900470
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAP1 siRNA

20-abx908271
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAP1 siRNA

20-abx908272
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAP1 Blocking Peptide

DF8746-BP 1mg
EUR 195

ASAP1 cloning plasmid

CSB-CL891546HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 111
  • Sequence: atgaatgcacatctctcagatgtgttgaagcatccattgcatccattttttattattttcttagttttgttcttggacaaatttaaacttttaaaagattattcaagatga
Description: A cloning plasmid for the ASAP1 gene.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Rat ASAP1 shRNA Plasmid

20-abx989848
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ASAP1 shRNA Plasmid

20-abx959406
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ASAP1 shRNA Plasmid

20-abx969968
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAP1 ORF Vector (Human) (pORF)

ORF000669 1.0 ug DNA
EUR 95

Asap1 ORF Vector (Mouse) (pORF)

ORF039139 1.0 ug DNA
EUR 506

Asap1 ORF Vector (Rat) (pORF)

ORF063705 1.0 ug DNA
EUR 506

ASAP1 sgRNA CRISPR Lentivector set (Human)

K0130801 3 x 1.0 ug
EUR 339

Asap1 sgRNA CRISPR Lentivector set (Mouse)

K4677601 3 x 1.0 ug
EUR 339

Asap1 sgRNA CRISPR Lentivector set (Rat)

K6295201 3 x 1.0 ug
EUR 339

ASAP1-IT1 ORF Vector (Human) (pORF)

ORF015844 1.0 ug DNA Ask for price

ASAP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0130802 1.0 ug DNA
EUR 154

ASAP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0130803 1.0 ug DNA
EUR 154

ASAP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0130804 1.0 ug DNA
EUR 154

Asap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4677602 1.0 ug DNA
EUR 154

Asap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4677603 1.0 ug DNA
EUR 154

Asap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4677604 1.0 ug DNA
EUR 154

Asap1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6295202 1.0 ug DNA
EUR 154

Asap1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6295203 1.0 ug DNA
EUR 154

Asap1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6295204 1.0 ug DNA
EUR 154

ASAP1 Protein Vector (Human) (pPB-C-His)

PV002673 500 ng
EUR 329

ASAP1 Protein Vector (Human) (pPB-N-His)

PV002674 500 ng
EUR 329

ASAP1 Protein Vector (Human) (pPM-C-HA)

PV002675 500 ng
EUR 329

ASAP1 Protein Vector (Human) (pPM-C-His)

PV002676 500 ng
EUR 329

ASAP1 Protein Vector (Human) (pPB-His-MBP)

PV324150 500 ng
EUR 329

ASAP1 Protein Vector (Human) (pPB-His-GST)

PV324151 500 ng
EUR 329

Anti-ASAP1 antibody