Anti-ASAP1 antibody 

To Order Contact us: stephen@expresspharmapulse.com

Anti-ASAP1 (1B5)
YF-MA18363	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ASAP1

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Anti-Phospho-ASAP1 Y782 Antibody
P03848	BosterBio	100ug	EUR 432
Description: Rabbit Polyclonal Phospho-ASAP1 Y782 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

ASAP1 antibody
ABD8746	Lifescience Market	100 ug	EUR 438

ASAP1 antibody
10-2474	Fitzgerald	250 ug	EUR 492
Description: Mouse monoclonal ASAP1 antibody

ASAP1
45464-100ul	SAB	100ul	EUR 252

ASAP1
45464-50ul	SAB	50ul	EUR 187

ASAP1
DF8746	Affbiotech	200ul	EUR 304
Description: ASAP1detects endogenous levels of total ASAP1.

ASAP1 Conjugated Antibody
C45464	SAB	100ul	EUR 397

ASAP1 siRNA
20-abx900470	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAP1 siRNA
20-abx908271	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAP1 siRNA
20-abx908272	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ASAP1 Blocking Peptide
DF8746-BP	Affbiotech	1mg	EUR 195

ASAP1 cloning plasmid
CSB-CL891546HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 111 Sequence: atgaatgcacatctctcagatgtgttgaagcatccattgcatccattttttattattttcttagttttgttcttggacaaatttaaacttttaaaagattattcaagatga
Description: A cloning plasmid for the ASAP1 gene.

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

Rat ASAP1 shRNA Plasmid
20-abx989848	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ASAP1 shRNA Plasmid
20-abx959406	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ASAP1 shRNA Plasmid
20-abx969968	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ASAP1 ORF Vector (Human) (pORF)
ORF000669	ABM	1.0 ug DNA	EUR 95

Asap1 ORF Vector (Mouse) (pORF)
ORF039139	ABM	1.0 ug DNA	EUR 506

Asap1 ORF Vector (Rat) (pORF)
ORF063705	ABM	1.0 ug DNA	EUR 506

ASAP1 sgRNA CRISPR Lentivector set (Human)
K0130801	ABM	3 x 1.0 ug	EUR 339

Asap1 sgRNA CRISPR Lentivector set (Mouse)
K4677601	ABM	3 x 1.0 ug	EUR 339

Asap1 sgRNA CRISPR Lentivector set (Rat)
K6295201	ABM	3 x 1.0 ug	EUR 339

ASAP1-IT1 ORF Vector (Human) (pORF)
ORF015844	ABM	1.0 ug DNA	Ask for price

ASAP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0130802	ABM	1.0 ug DNA	EUR 154

ASAP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0130803	ABM	1.0 ug DNA	EUR 154

ASAP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0130804	ABM	1.0 ug DNA	EUR 154

Asap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4677602	ABM	1.0 ug DNA	EUR 154

Asap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4677603	ABM	1.0 ug DNA	EUR 154

Asap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4677604	ABM	1.0 ug DNA	EUR 154

Asap1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6295202	ABM	1.0 ug DNA	EUR 154

Asap1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6295203	ABM	1.0 ug DNA	EUR 154

Asap1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6295204	ABM	1.0 ug DNA	EUR 154

ASAP1 Protein Vector (Human) (pPB-C-His)
PV002673	ABM	500 ng	EUR 329

ASAP1 Protein Vector (Human) (pPB-N-His)
PV002674	ABM	500 ng	EUR 329

ASAP1 Protein Vector (Human) (pPM-C-HA)
PV002675	ABM	500 ng	EUR 329

ASAP1 Protein Vector (Human) (pPM-C-His)
PV002676	ABM	500 ng	EUR 329

ASAP1 Protein Vector (Human) (pPB-His-MBP)
PV324150	ABM	500 ng	EUR 329

ASAP1 Protein Vector (Human) (pPB-His-GST)
PV324151	ABM	500 ng	EUR 329

Anti-ASAP1 antibody