NanoGram SDS Assay kit 

To Order Contact us: stephen@expresspharmapulse.com

SDS antibody

10R-5718 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5720 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

70R-3627 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the N terminal of SDS

SDS antibody

70R-3762 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS siRNA

20-abx904833
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDS siRNA

20-abx932743
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDS siRNA

20-abx932744
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

10% SDS

TG4060 1ml
EUR 134

anti-SDS

YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS

Mouse Sds ELISA KIT

ELI-19881m 96 Tests
EUR 865

Human SDS ELISA KIT

ELI-29707h 96 Tests
EUR 824

SDS ELISA KIT|Human

EF005552 96 Tests
EUR 689

Bovine SDS ELISA KIT

ELI-53006b 96 Tests
EUR 928

Residual SDS Detection Kit

BSP055 100Assays
EUR 83.06
  • Product category: Molecular Biology Kits/SDS Detection

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

SDS-PAGE Gel Preparation Kit

AR0138 1kit (Enough for 30-50 pieces of gel.)
EUR 96

SDS-PAGE Gel Preparation Kit

abx090646-1Kit 1 Kit
EUR 203
  • Shipped within 5-10 working days.

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

101Bio SDS-Remover

P5W12 NULL
EUR 0

100G SDS Ultrapure

NAT1072 100G
EUR 93

1KG SDS Ultrapure

NAT1074 1KG
EUR 306

10% SDS Solution

S0792-050 500ml
EUR 93

10% SDS Solution

S0792-100 2X500ml
EUR 122

20% SDS Solution

S0793-050 500ml
EUR 120

20% SDS Solution

S0793-100 2X500ml
EUR 166

SurfactAway™ SDS

SA645-30 30 mL
EUR 379

SurfactAway™ SDS

SA646-250 250 mL
EUR 1389

Anti-SDS antibody

STJ114764 100 µl
EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.

Anti-SDS (1A9)

YF-MA17551 100 ug
EUR 363
Description: Mouse monoclonal to SDS

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Serine Dehydratase(SDS)ELISA Kit

QY-E01421 96T
EUR 361

In Vitro SDS-K+ Precipitation Kit

TG1010-1 100 assays
EUR 459

In Vitro SDS-K+ Precipitation Kit

TG1010-2 250 assays
EUR 571

In Vivo SDS-K+ Precipitation Kit

TG1011-1 100 assays
EUR 302

In Vivo SDS-K+ Precipitation Kit

TG1011-2 250 assays
EUR 414

AE-1390 SDS-eliminant

2332390 2unit
EUR 301
Description: SDS r emoval r eagent

Rat SDS shRNA Plasmid

20-abx984756
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SDS Polyclonal Conjugated Antibody

C27842 100ul
EUR 397

Human SDS shRNA Plasmid

20-abx957508
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SDS shRNA Plasmid

20-abx981902
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

100ML SDS Solution 20%

NAT1228 100ML
EUR 77

450ML SDS Solution 20%

NAT1230 450ML
EUR 115

SDS, 99% Ultra Pure

S0800-100 1Kg
EUR 313

SDS, 99% Ultra Pure

S0800-250 2.5 Kg
EUR 536

SDS, 99% Ultra Pure

S0800-500 5 Kg
EUR 955

SDS Recombinant Protein (Human)

RP027868 100 ug Ask for price

SDS Recombinant Protein (Rat)

RP227840 100 ug Ask for price

SDS Recombinant Protein (Mouse)

RP170486 100 ug Ask for price

SDS-Urea-Tris solution

SB8896 500ml
EUR 74.36
  • Product category: Biochemicals/Biological Buffers/Common Buffers

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

TG-SDS Buffer (Trisbase-Glycine-SDS) 10X Premix powder - 1PK(4L)

A0031 4L
EUR 74.36
  • Product category: Biochemicals/Biological Buffers/Common Buffers

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Glycosaminoglycans Assay Kit

6022 1 kit
EUR 419.75
Description: Glycosaminoglycans Assay Kit

DNA Assay Kit

6023 1 kit
EUR 180.5
Description: DNA Assay Kit

Hemoglobin Assay Kit

6024 1 kit
EUR 180.5
Description: Hemoglobin Assay Kit

Proteasome Assay Kit

55R-1341 100 assays
EUR 654
Description: Assay Kit for detection of Proteasome in the research laboratory

Calpain Assay Kit

55R-1342 100 assays
EUR 779
Description: Assay Kit for detection of Calpain in the research laboratory

Glutathione Assay Kit

55R-1343 100 assays
EUR 654
Description: Assay Kit for detection of Glutathione in the research laboratory

Glutathione Assay Kit

55R-1354 100 assays
EUR 895
Description: Assay Kit for detection of Glutathione activity in the research laboratory

HDAC Assay Kit

55R-1371 100 assays
EUR 673
Description: Assay Kit for detection of HDAC in the research laboratory

HDAC Assay Kit

55R-1372 100 assays
EUR 673
Description: Assay Kit for detection of HDAC in the research laboratory

HAT Assay Kit

55R-1373 100 assays
EUR 740
Description: Assay Kit for detection of HAT in the research laboratory

SOD Assay Kit

55R-1374 100 assays
EUR 602
Description: Assay Kit for detection of SOD in the research laboratory

HDAC3 Assay Kit

55R-1377 100 assays
EUR 693
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC8 Assay Kit

55R-1379 100 assays
EUR 689
Description: Assay Kit for detection of HDAC8 in the research laboratory

ATP Assay Kit

55R-1380 100 assays
EUR 809
Description: Assay Kit for detection of ATP in the research laboratory

ADP Assay Kit

55R-1381 100 assays
EUR 809
Description: Assay Kit for detection of ADP in the research laboratory

FAD Assay Kit

55R-1382 100 assays
EUR 732
Description: Assay Kit for detection of FAD in the research laboratory

PEP Assay Kit

55R-1384 100 assays
EUR 876
Description: Assay Kit for detection of PEP in the research laboratory

Ammonia Assay Kit

55R-1388 100 assays
EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

cAMP Assay Kit

55R-1389 100 assays
EUR 706
Description: Assay Kit for detection of cAMP activity in the research laboratory

cGMP Assay Kit

55R-1390 100 assays
EUR 706
Description: Assay Kit for detection of cGMP activity in the research laboratory

Urea Assay Kit

55R-1391 100 assays
EUR 740
Description: Assay Kit for detection of Urea in the research laboratory

Calcium Assay Kit

55R-1392 250 assays
EUR 586
Description: Assay Kit for detection of Calcium activity in the research laboratory

Magnesium Assay Kit

55R-1393 100 assays
EUR 654
Description: Assay Kit for detection of Magnesium in the research laboratory

Zinc Assay Kit

55R-1394 100 assays
EUR 673
Description: Assay Kit for detection of Zinc in the research laboratory

Iron Assay Kit

55R-1395 100 assays
EUR 758
Description: Assay Kit for detection of Iron in the research laboratory

Phosphate Assay Kit

55R-1400 500 assays
EUR 415
Description: Assay Kit for detection of Phosphate in the research laboratory

JNK Assay Kit

55R-1407 40 assays
EUR 868
Description: Assay Kit for detection of JNK in the research laboratory

JNK Assay Kit

55R-1408 40 assays
EUR 979
Description: Assay Kit for detection of JNK in the research laboratory

Akt Assay Kit

55R-1409 40 assays
EUR 979
Description: Assay Kit for detection of Akt in the research laboratory

Ammonia Assay Kit

55R-1410 100 assays
EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

Cobalt Assay Kit

55R-1435 100 assays
EUR 621
Description: Assay Kit for detection of Cobalt in the research laboratory

Nickel Assay Kit

55R-1436 100 assays
EUR 621
Description: Assay Kit for detection of Nickel in the research laboratory

Chloride Assay Kit

55R-1437 100 assays
EUR 484
Description: Assay Kit for detection of Chloride in the research laboratory

Aspartate Assay Kit

55R-1438 100 assays
EUR 673
Description: Assay Kit for detection of Aspartate in the research laboratory

Hydroxyproline Assay Kit

55R-1439 100 assays
EUR 844
Description: Assay Kit for detection of Hydroxyproline in the research laboratory

Phenylalanine Assay Kit

55R-1442 100 assays
EUR 654
Description: Assay Kit for detection of Phenylalanine in the research laboratory

Phosphatidylcholine Assay Kit

55R-1443 100 assays
EUR 673
Description: Assay Kit for detection of Phosphatidylcholine in the research laboratory

Glucose Assay Kit

55R-1449 100 assays
EUR 706
Description: Assay Kit for detection of Glucose in the research laboratory

Lactate Assay Kit

55R-1450 100 assays
EUR 844
Description: Assay Kit for detection of Lactate in the research laboratory

Pyruvate Assay Kit

55R-1452 100 assays
EUR 844
Description: Assay Kit for detection of Pyruvate in the research laboratory

Adipogenesis Assay Kit

55R-1454 100 assays
EUR 586
Description: Assay Kit for detection of Adipogenesis in the research laboratory

Glucose Assay Kit

55R-1458 100 assays
EUR 740
Description: Assay Kit for detection of Glucose in the research laboratory

Galactose Assay Kit

55R-1459 100 assays
EUR 740
Description: Assay Kit for detection of Galactose in the research laboratory

Maltose Assay Kit

55R-1460 100 assays
EUR 723
Description: Assay Kit for detection of Maltose in the research laboratory

Fructose Assay Kit

55R-1461 100 assays
EUR 689
Description: Assay Kit for detection of Fructose in the research laboratory

Ethanol Assay Kit

55R-1462 100 assays
EUR 774
Description: Assay Kit for detection of Ethanol in the research laboratory

Galactose Assay Kit

55R-1463 100 assays
EUR 706
Description: Assay Kit for detection of Galactose in the research laboratory

Lactose Assay Kit

55R-1466 100 assays
EUR 706
Description: Assay Kit for detection of Lactose in the research laboratory

Creatinine Assay Kit

55R-1467 100 assays
EUR 638
Description: Assay Kit for detection of Creatinine in the research laboratory

Sucrose Assay Kit

55R-1468 100 assays
EUR 689
Description: Assay Kit for detection of Sucrose in the research laboratory

Lactate Assay Kit

55R-1469 100 assays
EUR 844
Description: Assay Kit for detection of Lactate in the research laboratory

Maltose Assay Kit

55R-1470 100 assays
EUR 706
Description: Assay Kit for detection of Maltose in the research laboratory

Glutamate Assay Kit

55R-1471 100 assays
EUR 740
Description: Assay Kit for detection of Glutamate in the research laboratory

Fumarate Assay Kit

55R-1475 100 assays
EUR 706
Description: Assay Kit for detection of Fumarate in the research laboratory

Creatine Assay Kit

55R-1476 100 assays
EUR 654
Description: Assay Kit for detection of Creatine in the research laboratory

Sarcosine Assay Kit

55R-1477 100 assays
EUR 654
Description: Assay Kit for detection of Sarcosine in the research laboratory

Malate Assay Kit

55R-1478 100 assays
EUR 673
Description: Assay Kit for detection of Malate in the research laboratory

Glycogen Assay Kit

55R-1481 100 assays
EUR 844
Description: Assay Kit for detection of Glycogen in the research laboratory

Starch Assay Kit

55R-1482 100 assays
EUR 673
Description: Assay Kit for detection of Starch in the research laboratory

Alanine Assay Kit

55R-1483 100 assays
EUR 654
Description: Assay Kit for detection of Alanine in the research laboratory

Formate Assay Kit

55R-1484 100 assays
EUR 809
Description: Assay Kit for detection of Formate in the research laboratory

Citrate Assay Kit

55R-1485 100 assays
EUR 740
Description: Assay Kit for detection of Citrate in the research laboratory

Isocitrate Assay Kit

55R-1486 100 assays
EUR 663
Description: Assay Kit for detection of Isocitrate in the research laboratory

Oxaloacetate Assay Kit

55R-1488 100 assays
EUR 663
Description: Assay Kit for detection of Oxaloacetate in the research laboratory

Heme Assay Kit

55R-1492 100 assays
EUR 673
Description: Assay Kit for detection of Heme in the research laboratory

Glucose Assay Kit

55R-1494 100 assays
EUR 706
Description: Assay Kit for detection of Glucose in the research laboratory

NanoGram SDS Assay kit