NanoGram SDS Assay kit 

To Order Contact us:

SDS antibody

70R-3762 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS Solution

EUR 137

SDS antibody

10R-5712 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5718 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5720 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

10% SDS

TG4060 1ml
EUR 134


YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS


ELI-19881m 96 Tests
EUR 865


EF005552 96 Tests
EUR 689


ELI-53006b 96 Tests
EUR 928


ELI-29707h 96 Tests
EUR 824

Residual SDS Detection Kit

BSP055 100Assays
EUR 83.06
  • Product category: Molecular Biology Kits/SDS Detection

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

SDS-PAGE Gel Preparation Kit

AR0138 1kit (Enough for 30-50 pieces of gel.)
EUR 96

SDS-PAGE Gel Preparation Kit

abx090646-1Kit 1 Kit
EUR 203
  • Shipped within 5-10 working days.

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

100G SDS Ultrapure

NAT1072 100G
EUR 93

1KG SDS Ultrapure

NAT1074 1KG
EUR 306

101Bio SDS-Remover


10% SDS Solution

S0792-050 500ml
EUR 93

10% SDS Solution

S0792-100 2X500ml
EUR 122

20% SDS Solution

S0793-050 500ml
EUR 120

20% SDS Solution

S0793-100 2X500ml
EUR 166

SurfactAway™ SDS

SA645-30 30 mL
EUR 379

SurfactAway™ SDS

SA646-250 250 mL
EUR 1389

Anti-SDS antibody

STJ114764 100 µl
EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.

Anti-SDS (1A9)

YF-MA17551 100 ug
EUR 363
Description: Mouse monoclonal to SDS

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Serine Dehydratase(SDS)ELISA Kit

QY-E01421 96T
EUR 361

In Vitro SDS-K+ Precipitation Kit

TG1010-1 100 assays
EUR 459

In Vitro SDS-K+ Precipitation Kit

TG1010-2 250 assays
EUR 571

In Vivo SDS-K+ Precipitation Kit

TG1011-1 100 assays
EUR 302

In Vivo SDS-K+ Precipitation Kit

TG1011-2 250 assays
EUR 414

SDS Polyclonal Conjugated Antibody

C27842 100ul
EUR 397

Rat SDS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SDS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AE-1390 SDS-eliminant

2332390 2unit
EUR 301
Description: SDS r emoval r eagent

Mouse SDS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

100ML SDS Solution 20%

NAT1228 100ML
EUR 77

450ML SDS Solution 20%

NAT1230 450ML
EUR 115

SDS, 99% Ultra Pure

S0800-100 1Kg
EUR 313

SDS, 99% Ultra Pure

S0800-250 2.5 Kg
EUR 536

SDS, 99% Ultra Pure

S0800-500 5 Kg
EUR 955

SDS Recombinant Protein (Human)

RP027868 100 ug Ask for price

SDS Recombinant Protein (Rat)

RP227840 100 ug Ask for price

SDS Recombinant Protein (Mouse)

RP170486 100 ug Ask for price

SDS-Urea-Tris solution

SB8896 500ml
EUR 74.36
  • Product category: Biochemicals/Biological Buffers/Common Buffers

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

TG-SDS Buffer (Trisbase-Glycine-SDS) 10X Premix powder - 1PK(4L)

A0031 4L
EUR 74.36
  • Product category: Biochemicals/Biological Buffers/Common Buffers

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Histamine Assay Kit

AKR-360 96 assays
EUR 519
Description: Histamine is naturally occurring in food, with high concentrations associated with spoiled and fermented foods. Exposure to high levels of histamine through the ingestion of food can cause symptoms similar to an allergic response. Our Histamine Assay Kit detects total histamine from food samples using a colorimetric probe. Reduction of the probe yields color development proportional the histamine levels in the sample. Absorbance at 450nm is read after a one hour incubation at 37C and histamine levels are calculated based on a histamine standard curve.

Glucose Assay Kit

abx090673-1Kit 1 Kit
EUR 237
  • Shipped within 5-10 working days.

ADA Assay Kit

abx090675-100tests 100 tests
EUR 237
  • Shipped within 5-10 working days.

Glutamate Assay Kit

abx096004-100Assays 100 Assays
EUR 441
  • Shipped within 5-10 working days.

Glutathione Assay Kit

abx096005-100Assays 100 Assays
EUR 378
  • Shipped within 5-10 working days.

Trehalase Assay Kit

abx096014-100Assays 100 Assays
EUR 551
  • Shipped within 5-10 working days.

Pyruvate Assay Kit

abx097982-100Assays 100 Assays
EUR 472
  • Shipped within 5-10 working days.

NADPase Assay Kit

abx097983-100Assays 100 Assays
EUR 504
  • Shipped within 5-10 working days.

Starch Assay Kit

abx097988-100Assays 100 Assays
EUR 441
  • Shipped within 5-10 working days.

Trehalose Assay Kit

abx097995-100Assays 100 Assays
EUR 472
  • Shipped within 5-10 working days.

ADA Assay Kit

abx098403-Hitachi7060R190ml2R290ml1 Hitachi 7060; R1: 90ml×2 R2: 90ml×1
EUR 739
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Hitachi7170R140ml4R220ml4 Hitachi 7170; R1: 40ml×4 R2: 20ml×4
EUR 801
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Hitachi7170R160ml4R260ml2 Hitachi 7170; R1: 60ml×4 R2: 60ml×2
EUR 911
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Toshiba40R150ml4R250ml2 Toshiba 40; R1: 50ml×4 R2: 50ml×2
EUR 786
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-Hitachi7020R140ml2R240ml2 Hitachi 7020; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-Hitachi7060R190ml1R290ml1 Hitachi 7060; R1: 90ml×1 R2: 90ml×1
EUR 206
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-Toshiba40R140ml2R240ml2 Toshiba 40; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Calcium Assay Kit

abx098414-UniversalR140ml2R240ml2 Universal; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 300
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Hitachi7170R140ml3R230ml1 Hitachi 7170; R1: 40ml×3 R2: 30ml×1
EUR 316
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Hitachi7170R160ml2R230ml1 Hitachi 7170; R1: 60ml×2 R2: 30ml×1
EUR 316
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-Toshiba40R140ml4R240ml1 Toshiba 40; R1: 40ml×4 R2: 40ml×1
EUR 331
  • Shipped within 5-12 working days.

Cholinesterase Assay Kit

abx098416-UniversalR160ml2R215ml2 Universal; R1: 60ml×2 R2: 15ml×2
EUR 316
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Hitachi7020R150ml3R250ml1 Hitachi 7020; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Hitachi7060R190ml2R260ml1 Hitachi 7060; R1: 90ml×2 R2: 60ml×1
EUR 472
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba120R140ml3R240ml1 Toshiba 120; R1: 40ml×3 R2: 40ml×1
EUR 566
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba120R150ml3R250ml1 Toshiba 120; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Creatinine Assay Kit

abx098422-Toshiba40R150ml3R250ml1 Toshiba 40; R1: 50ml×3 R2: 50ml×1
EUR 519
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7020R140ml2R220ml1 Hitachi 7020; R1: 40ml×2 R2: 20ml×1
EUR 253
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7060R190ml2R245ml1 Hitachi 7060; R1: 90ml×2 R2: 45ml×1
EUR 253
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 206
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7170R140ml12R240ml3 Hitachi 7170; R1: 40ml×12 R2: 40ml×3
EUR 222
  • Shipped within 5-12 working days.

Fructosamine Assay Kit

abx098427-Hitachi7170R140ml2R220ml1 Hitachi 7170; R1: 40ml×2 R2: 20ml×1
EUR 253
  • Shipped within 5-12 working days.

Glucose Assay Kit

abx098429-Hitachi7020R140ml4R240ml1 Hitachi 7020; R1: 40ml×4 R2: 40ml×1
EUR 222
  • Shipped within 5-12 working days.

Glucose Assay Kit

abx098429-Hitachi7060R190ml2R245ml1 Hitachi 7060; R1: 90ml×2 R2: 45ml×1
EUR 222
  • Shipped within 5-12 working days.

Glucose Assay Kit

abx098429-Hitachi7170R132ml4R28ml4 Hitachi 7170; R1: 32ml×4 R2: 8ml×4
EUR 222
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-BeckmanR140ml1R210ml1 Beckman; R1: 40ml×1 R2: 10ml×1
EUR 347
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1: 40ml×1 R2: 10ml×1
EUR 347
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 269
  • Shipped within 5-12 working days.

Haptoglobin Assay Kit

abx098432-Toshiba40R140ml1R210ml1 Toshiba 40; R1: 40ml×1 R2: 10ml×1
EUR 347
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-Hitachi7060R160ml1R210ml1 Hitachi 7060; R1: 60ml×1 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-Hitachi7170R130ml2R210ml1 Hitachi 7170; R1: 30ml×2 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-Toshiba40R130ml2R210ml1 Toshiba 40; R1: 30ml×2 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Homocysteine Assay Kit

abx098434-UniversalR130ml2R210ml1 Universal; R1: 30ml×2 R2: 10ml×1
EUR 1036
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1:40ml×1 R2:10ml×1
EUR 206
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Hitachi7170R140ml1R210ml1 Hitachi 7170; R1:40ml×1 R2:10ml×1
EUR 206
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Hitachi7170R160ml1R215ml1 Hitachi 7170; R1:60ml×1 R2:15ml×1
EUR 222
  • Shipped within 5-12 working days.

Iron Assay Kit

abx098439-Toshiba40R140ml1R210ml1 Toshiba 40; R1:40ml×1 R2:10ml×1
EUR 206
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-BeckmanR180ml1R220ml1 Beckman; R1:80ml×1 R2:20ml×1
EUR 692
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-Hitachi7170R140ml2R220ml1 Hitachi 7170; R1:40ml×2 R2:20ml×1
EUR 692
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-Hitachi7170R160ml1R215ml1 Hitachi 7170; R1:60ml×1 R2:15ml×1
EUR 566
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-Toshiba40R140ml1R210ml1 Toshiba 40; R1:40ml×1 R2:10ml×1
EUR 441
  • Shipped within 5-12 working days.

Lipase Assay Kit

abx098442-UniversalR120ml1R25ml1 Universal; R1:20ml×1 R2:5ml×1
EUR 316
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Hitachi7020R140ml2R240ml2 Hitachi 7020; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Hitachi7060R190ml1R290ml1 Hitachi 7060; R1: 90ml×1 R2: 90ml×1
EUR 206
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Toshiba40R140ml2R240ml2 Toshiba 40; R1: 40ml×2 R2: 40ml×2
EUR 206
  • Shipped within 5-12 working days.

Magnesium Assay Kit

abx098445-Toshiba40R150ml2R250ml2 Toshiba 40; R1: 50ml×2 R2: 50ml×2
EUR 206
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7060R150ml1R210ml1 Hitachi 7060; R1: 50ml×1 R2: 10ml×1
EUR 363
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7060R150ml3R230ml1 Hitachi 7060; R1: 50ml×3 R2: 30ml×1
EUR 363
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7170R125ml1R25ml1 Hitachi 7170; R1: 25ml×1 R2: 5ml×1
EUR 269
  • Shipped within 5-12 working days.

Microalbumin Assay KIt

abx098446-Hitachi7170R150ml1R210ml1 Hitachi 7170; R1: 50ml×1 R2: 10ml×1
EUR 363
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1: 40ml×1 R2: 10ml×1
EUR 1193
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Hitachi7170R120ml1R25ml1 Hitachi 7170; R1: 20ml×1 R2: 5ml×1
EUR 692
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Hitachi7170R140ml1R210ml1 Hitachi 7170; R1: 40ml×1 R2: 10ml×1
EUR 1193
  • Shipped within 5-12 working days.

Myoglobin Assay Kit

abx098448-Toshiba40R140ml1R210ml1 Toshiba 40; R1: 40ml×1 R2: 10ml×1
EUR 1193
  • Shipped within 5-12 working days.

NGAL Assay Kit

abx098449-Hitachi7020R140ml1R210ml1 Hitachi 7020; R1: 40ml×1 R2: 10ml×1
EUR 942
  • Shipped within 5-12 working days.

NanoGram SDS Assay kit