NanoGram SDS Assay kit 

To Order Contact us: stephen@expresspharmapulse.com

SDS antibody
10R-5718	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody
10R-5720	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody
70R-3627	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SDS antibody raised against the N terminal of SDS

SDS antibody
70R-3762	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS siRNA
20-abx904833	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SDS siRNA
20-abx932743	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SDS siRNA
20-abx932744	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

10% SDS
TG4060	TopoGen	1ml	EUR 134

anti-SDS
YF-PA17352	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SDS

Mouse Sds ELISA KIT
ELI-19881m	Lifescience Market	96 Tests	EUR 865

Human SDS ELISA KIT
ELI-29707h	Lifescience Market	96 Tests	EUR 824

SDS ELISA KIT|Human
EF005552	Lifescience Market	96 Tests	EUR 689

Bovine SDS ELISA KIT
ELI-53006b	Lifescience Market	96 Tests	EUR 928

Residual SDS Detection Kit
BSP055	Bio Basic	100Assays	EUR 83.06
Product category: Molecular Biology Kits/SDS Detection

dAbs scaffold protein anti-Human B5R
SDS-L073	Creative Biolabs	1 mg	EUR 4496
Description: Scaffold protein

SDS-PAGE Gel Preparation Kit
AR0138	BosterBio	1kit (Enough for 30-50 pieces of gel.)	EUR 96

SDS-PAGE Gel Preparation Kit
abx090646-1Kit	Abbexa	1 Kit	EUR 203
Shipped within 5-10 working days.

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution
A0030	Bio Basic	4L	EUR 94.8
Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder
TD8135	Bio Basic	1PK, 10L	EUR 76.1
Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4
UA0030	Bio Basic	500ml	EUR 67.4
Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Polyclonal Antibody
27842-100ul	SAB	100ul	EUR 252

SDS Polyclonal Antibody
27842-50ul	SAB	50ul	EUR 187

SDS Rabbit pAb
A12898-100ul	Abclonal	100 ul	EUR 308

SDS Rabbit pAb
A12898-200ul	Abclonal	200 ul	EUR 459

SDS Rabbit pAb
A12898-20ul	Abclonal	20 ul	EUR 183

SDS Rabbit pAb
A12898-50ul	Abclonal	50 ul	EUR 223

SDS Blocking Peptide
33R-4446	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide
33R-1011	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid
CSB-CL020926HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 657 Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca Show more
Description: A cloning plasmid for the SDS gene.

101Bio SDS-Remover
P5W12	101Bio	NULL	EUR 0

100G SDS Ultrapure
NAT1072	National Diagnostics	100G	EUR 93

1KG SDS Ultrapure
NAT1074	National Diagnostics	1KG	EUR 306

10% SDS Solution
S0792-050	GenDepot	500ml	EUR 93

10% SDS Solution
S0792-100	GenDepot	2X500ml	EUR 122

20% SDS Solution
S0793-050	GenDepot	500ml	EUR 120

20% SDS Solution
S0793-100	GenDepot	2X500ml	EUR 166

SurfactAway™ SDS
SA645-30	Biotech Support Group	30 mL	EUR 379

SurfactAway™ SDS
SA646-250	Biotech Support Group	250 mL	EUR 1389

Anti-SDS antibody
STJ114764	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.

Anti-SDS (1A9)
YF-MA17551	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SDS

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human Serine Dehydratase(SDS)ELISA Kit
QY-E01421	Qayee Biotechnology	96T	EUR 361

In Vitro SDS-K+ Precipitation Kit
TG1010-1	TopoGen	100 assays	EUR 459

In Vitro SDS-K+ Precipitation Kit
TG1010-2	TopoGen	250 assays	EUR 571

In Vivo SDS-K+ Precipitation Kit
TG1011-1	TopoGen	100 assays	EUR 302

In Vivo SDS-K+ Precipitation Kit
TG1011-2	TopoGen	250 assays	EUR 414

AE-1390 SDS-eliminant
2332390	Atto	2unit	EUR 301
Description: SDS r emoval r eagent

Rat SDS shRNA Plasmid
20-abx984756	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SDS Polyclonal Conjugated Antibody
C27842	SAB	100ul	EUR 397

Human SDS shRNA Plasmid
20-abx957508	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SDS shRNA Plasmid
20-abx981902	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

100ML SDS Solution 20%
NAT1228	National Diagnostics	100ML	EUR 77

450ML SDS Solution 20%
NAT1230	National Diagnostics	450ML	EUR 115

SDS, 99% Ultra Pure
S0800-100	GenDepot	1Kg	EUR 313

SDS, 99% Ultra Pure
S0800-250	GenDepot	2.5 Kg	EUR 536

SDS, 99% Ultra Pure
S0800-500	GenDepot	5 Kg	EUR 955

SDS Recombinant Protein (Human)
RP027868	ABM	100 ug	Ask for price

SDS Recombinant Protein (Rat)
RP227840	ABM	100 ug	Ask for price

SDS Recombinant Protein (Mouse)
RP170486	ABM	100 ug	Ask for price

SDS-Urea-Tris solution
SB8896	Bio Basic	500ml	EUR 74.36
Product category: Biochemicals/Biological Buffers/Common Buffers

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

TG-SDS Buffer (Trisbase-Glycine-SDS) 10X Premix powder - 1PK(4L)
A0031	Bio Basic	4L	EUR 74.36
Product category: Biochemicals/Biological Buffers/Common Buffers

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Glycosaminoglycans Assay Kit
6022	Chondrex	1 kit	EUR 419.75
Description: Glycosaminoglycans Assay Kit

DNA Assay Kit
6023	Chondrex	1 kit	EUR 180.5
Description: DNA Assay Kit

Hemoglobin Assay Kit
6024	Chondrex	1 kit	EUR 180.5
Description: Hemoglobin Assay Kit

Proteasome Assay Kit
55R-1341	Fitzgerald	100 assays	EUR 654
Description: Assay Kit for detection of Proteasome in the research laboratory

Calpain Assay Kit
55R-1342	Fitzgerald	100 assays	EUR 779
Description: Assay Kit for detection of Calpain in the research laboratory

Glutathione Assay Kit
55R-1343	Fitzgerald	100 assays	EUR 654
Description: Assay Kit for detection of Glutathione in the research laboratory

Glutathione Assay Kit
55R-1354	Fitzgerald	100 assays	EUR 895
Description: Assay Kit for detection of Glutathione activity in the research laboratory

HDAC Assay Kit
55R-1371	Fitzgerald	100 assays	EUR 673
Description: Assay Kit for detection of HDAC in the research laboratory

HDAC Assay Kit
55R-1372	Fitzgerald	100 assays	EUR 673
Description: Assay Kit for detection of HDAC in the research laboratory

HAT Assay Kit
55R-1373	Fitzgerald	100 assays	EUR 740
Description: Assay Kit for detection of HAT in the research laboratory

SOD Assay Kit
55R-1374	Fitzgerald	100 assays	EUR 602
Description: Assay Kit for detection of SOD in the research laboratory

HDAC3 Assay Kit
55R-1377	Fitzgerald	100 assays	EUR 693
Description: Assay Kit for detection of HDAC3 in the research laboratory

HDAC8 Assay Kit
55R-1379	Fitzgerald	100 assays	EUR 689
Description: Assay Kit for detection of HDAC8 in the research laboratory

ATP Assay Kit
55R-1380	Fitzgerald	100 assays	EUR 809
Description: Assay Kit for detection of ATP in the research laboratory

ADP Assay Kit
55R-1381	Fitzgerald	100 assays	EUR 809
Description: Assay Kit for detection of ADP in the research laboratory

FAD Assay Kit
55R-1382	Fitzgerald	100 assays	EUR 732
Description: Assay Kit for detection of FAD in the research laboratory

PEP Assay Kit
55R-1384	Fitzgerald	100 assays	EUR 876
Description: Assay Kit for detection of PEP in the research laboratory

Ammonia Assay Kit
55R-1388	Fitzgerald	100 assays	EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

cAMP Assay Kit
55R-1389	Fitzgerald	100 assays	EUR 706
Description: Assay Kit for detection of cAMP activity in the research laboratory

cGMP Assay Kit
55R-1390	Fitzgerald	100 assays	EUR 706
Description: Assay Kit for detection of cGMP activity in the research laboratory

NanoGram SDS Assay kit