Human ITLN2(Intelectin 2) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Intelectin 2 (ITLN2) ELISA Kit

RD-ITLN2-Hu-96Tests 96 Tests
EUR 723

Human Intelectin 2 (ITLN2)ELISA Kit

201-12-2755 96 tests
EUR 440
  • This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

20-abx151998
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 2 (ITLN2) ELISA Kit

abx252683-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit

EH3280 96T
EUR 524.1
  • Detection range: 6.25-400 ng/ml
  • Uniprot ID: Q8WWU7
  • Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

Human Intelectin- 2, ITLN2 ELISA KIT

ELI-28050h 96 Tests
EUR 824

Human Intelectin 2(ITLN2)ELISA Kit

QY-E02126 96T
EUR 361

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

4-SEH773Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2
  • Endothelial lectin HL-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Intelectin 2 (ITLN2) Antibody

abx027537-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody

abx027537-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody

20-abx177020
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 2 (ITLN2) Antibody

abx037210-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody

20-abx172969
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Intelectin 2 (ITLN2) Protein

20-abx653899
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Human ITLN2 (Intelectin 2)

E-EL-H5562 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ITLN2 (Intelectin 2)

ELK3892 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 2 (ITLN2) CLIA Kit

20-abx495538
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ITLN2 ELISA KIT|Human

EF006945 96 Tests
EUR 689

ITLN2 ELISA Kit (Human) (OKCD01969)

OKCD01969 96 Wells
EUR 831
Description: Description of target: May play a role in the defense system against pathogens.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.06 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

ITLN2 Antibody

42927-100ul 100ul
EUR 252

ITLN2 Antibody

39630-100ul 100ul
EUR 390

ITLN2 antibody

70R-4496 50 ug
EUR 467
Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2

ITLN2 siRNA

20-abx920956
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Intelectin 1 (ITLN1)ELISA Kit

201-12-2754 96 tests
EUR 440
  • This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Hu-48T 48T
EUR 479
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Hu-96T 96T
EUR 621
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

20-abx151997
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 1 (ITLN1) ELISA Kit

abx253532-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Intelectin-1

EK2456 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ITLN1/ Intelectin-1 ELISA Kit

E1354Hu 1 Kit
EUR 537

Human ITLN1(Intelectin-1 ) ELISA Kit

EH0564 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q8WWA0
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Intelectin- 1, ITLN1 ELISA KIT

ELI-03070h 96 Tests
EUR 824

Human Intelectin 1(ITLN1)ELISA Kit

QY-E02127 96T
EUR 361

Human Intelectin 1 ELISA Kit (ITLN1)

RK01714 96 Tests
EUR 521

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

4-SEA933Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-48Tests 48 Tests
EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-96Tests 96 Tests
EUR 692

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-48Tests 48 Tests
EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-96Tests 96 Tests
EUR 662

Human ITLN2 shRNA Plasmid

20-abx965352
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ITLN2 Recombinant Protein (Human)

RP040183 100 ug Ask for price

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1106803 1.0 ug DNA
EUR 154

Human Intelectin 1/Omentin (ITLN1) ELISA Kit

abx055557-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Omentin/intelectin-1 PicoKine ELISA Kit

EK1849 96 wells
EUR 425
Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

ELISA kit for Human ITLN1 (Intelectin 1)

ELK2003 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 1/Omentin (ITLN1) ELISA Kit

abx574465-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

ITLN2 Blocking Peptide

33R-9353 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496

ITLN2 Conjugated Antibody

C42927 100ul
EUR 397

ITLN2 cloning plasmid

CSB-CL837867HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 975
  • Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg
  • Show more
Description: A cloning plasmid for the ITLN2 gene.

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-48T 48T
EUR 489
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-96T 96T
EUR 635
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-48T 48T
EUR 508
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-96T 96T
EUR 661
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

20-abx155707
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin 1 (ITLN1) ELISA Kit

20-abx154225
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin- 1a, Itln1 ELISA KIT

ELI-03069m 96 Tests
EUR 865

Mouse Intelectin 1a (ITLN1) ELISA Kit

abx575109-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Intelectin- 1b, Itln1b ELISA KIT

ELI-39394m 96 Tests
EUR 865

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

4-SEA933Mu
  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

4-SEA933Ra
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-48Tests 48 Tests
EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-96Tests 96 Tests
EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-48Tests 48 Tests
EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-96Tests 96 Tests
EUR 742

Mouse Intelectin 1 ELISA Kit (ITLN1)

RK02963 96 Tests
EUR 521

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-48Tests 48 Tests
EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-96Tests 96 Tests
EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-48Tests 48 Tests
EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-96Tests 96 Tests
EUR 709

ITLN2 ORF Vector (Human) (pORF)

ORF013395 1.0 ug DNA
EUR 354

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ELISA kit for Human ITLN1 (Intelectin 1/Omentin)

E-EL-H2028 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Human Intelectin 1 (ITLN1) CLIA Kit

20-abx492234
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Polyclonal ITLN2 Antibody (Center)

APR11252G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit

abx254237-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

abx255780-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

ELISA kit for Mouse ITLN1 (Intelectin 1)

ELK2004 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat ITLN1 (Intelectin 1)

ELK2005 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Monkey Intelectin 1/Omentin (ITLN1) ELISA Kit

abx359483-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Intelectin 1/Omentin (ITLN1) ELISA Kit

abx361255-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit

abx362579-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Intelectin 1/Omentin (ITLN1) ELISA Kit

abx356771-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

abx576145-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse ITLN1(Intelectin 1/Omentin) ELISA Kit

EM1180 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O88310
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat ITLN1(Intelectin 1/Omentin) ELISA Kit

ER1117 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-48T 48T
EUR 332
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-96T 96T
EUR 539
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ITLN1 ELISA Kit| Rat Intelectin 1/Omentin ELISA Kit

EF017857 96 Tests
EUR 689

ITLN1 ELISA Kit| Mouse Intelectin 1/Omentin ELISA Kit

EF013735 96 Tests
EUR 689

ITLN2 sgRNA CRISPR Lentivector set (Human)

K1106801 3 x 1.0 ug
EUR 339

Human Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195758-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Intelectin 1 (ITLN1) Protein

20-abx067298
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Mouse ITLN1 (Intelectin 1/Omentin)

E-EL-M0857 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ITLN1 (Intelectin 1/Omentin)

E-EL-R0689 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Guinea pig Intelectin 1/Omentin (ITLN1) ELISA Kit

abx357571-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1106802 1.0 ug DNA
EUR 154

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1106804 1.0 ug DNA
EUR 154

ITLN2 Protein Vector (Human) (pPB-C-His)

PV053577 500 ng
EUR 481

ITLN2 Protein Vector (Human) (pPB-N-His)

PV053578 500 ng
EUR 481

ITLN2 Protein Vector (Human) (pPM-C-HA)

PV053579 500 ng
EUR 481

ITLN2 Protein Vector (Human) (pPM-C-His)

PV053580 500 ng
EUR 481

Mouse Intelectin 1 (ITLN1) CLIA Kit

20-abx492235
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Intelectin 1 (ITLN1) CLIA Kit

20-abx492236
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

CLIA kit for Human ITLN1 (Intelectin 1/Omentin)

E-CL-H1228 1 plate of 96 wells
EUR 584
  • Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Intelectin 1 (ITLN1) Antibody

20-abx177019
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

20-abx212528
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody

20-abx101091
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

20-abx101092
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

20-abx101093
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

20-abx172967
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

20-abx172968
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Intelectin 1 (ITLN1)

4-RPA933Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWA0
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: 7.2
Description: Recombinant Human Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

4-RPA933Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88310
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: 8.8
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

4-RPA933Ra01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q499T8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Intelectin 1 expressed in: E.coli

ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1106807 1.0 ug DNA
EUR 167

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Mouse Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195759-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit