Human ITLN2(Intelectin 2) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Intelectin 2 (ITLN2) ELISA Kit
RD-ITLN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Intelectin 2 (ITLN2)ELISA Kit
201-12-2755	SunredBio	96 tests	EUR 440
This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
20-abx151998	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Intelectin 2 (ITLN2) ELISA Kit
abx252683-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit
EH3280	FN Test	96T	EUR 524.1
Detection range: 6.25-400 ng/ml Uniprot ID: Q8WWU7 Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

Human Intelectin- 2, ITLN2 ELISA KIT
ELI-28050h	Lifescience Market	96 Tests	EUR 824

Human Intelectin 2(ITLN2)ELISA Kit
QY-E02126	Qayee Biotechnology	96T	EUR 361

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
SEH773Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit
4-SEH773Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2 Endothelial lectin HL-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Intelectin 2 (ITLN2) Antibody
abx027537-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
abx027537-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
20-abx177020	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Intelectin 2 (ITLN2) Antibody
abx037210-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody
20-abx172969	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Human Intelectin 2 (ITLN2) Protein
20-abx653899	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Human ITLN2 (Intelectin 2)
E-EL-H5562	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ITLN2 (Intelectin 2)
ELK3892	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2 Show more
Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 2 (ITLN2) CLIA Kit
20-abx495538	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ITLN2 ELISA KIT|Human
EF006945	Lifescience Market	96 Tests	EUR 689

ITLN2 ELISA Kit (Human) (OKCD01969)
OKCD01969	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May play a role in the defense system against pathogens.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.06 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ITLN2 Antibody
42927-100ul	SAB	100ul	EUR 252

ITLN2 Antibody
39630-100ul	SAB	100ul	EUR 390

ITLN2 antibody
70R-4496	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2

ITLN2 siRNA
20-abx920956	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human Intelectin 1 (ITLN1)ELISA Kit
201-12-2754	SunredBio	96 tests	EUR 440
This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
20-abx151997	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Intelectin 1 (ITLN1) ELISA Kit
abx253532-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Intelectin-1
EK2456	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ITLN1/ Intelectin-1 ELISA Kit
E1354Hu	Sunlong	1 Kit	EUR 537

Human ITLN1(Intelectin-1 ) ELISA Kit
EH0564	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: Q8WWA0 Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Intelectin- 1, ITLN1 ELISA KIT
ELI-03070h	Lifescience Market	96 Tests	EUR 824

Human Intelectin 1(ITLN1)ELISA Kit
QY-E02127	Qayee Biotechnology	96T	EUR 361

Human Intelectin 1 ELISA Kit (ITLN1)
RK01714	Abclonal	96 Tests	EUR 521

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
SEA933Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1 INTL ITLN LFR HIntL Omentin Intelectin 1, Galactofuranose Binding Intestinal Lactoferrin Receptor Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human ITLN2 shRNA Plasmid
20-abx965352	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ITLN2 Recombinant Protein (Human)
RP040183	ABM	100 ug	Ask for price

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1106803	ABM	1.0 ug DNA	EUR 154

Human Intelectin 1/Omentin (ITLN1) ELISA Kit
abx055557-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Omentin/intelectin-1 PicoKine ELISA Kit
EK1849	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

ELISA kit for Human ITLN1 (Intelectin 1)
ELK2003	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1 Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 1/Omentin (ITLN1) ELISA Kit
abx574465-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

ITLN2 Blocking Peptide
33R-9353	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496

ITLN2 Conjugated Antibody
C42927	SAB	100ul	EUR 397

ITLN2 cloning plasmid
CSB-CL837867HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 975 Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg Show more
Description: A cloning plasmid for the ITLN2 gene.

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
DLR-ITLN1-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
20-abx155707	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Intelectin 1 (ITLN1) ELISA Kit
20-abx154225	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Intelectin- 1a, Itln1 ELISA KIT
ELI-03069m	Lifescience Market	96 Tests	EUR 865

Mouse Intelectin 1a (ITLN1) ELISA Kit
abx575109-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Intelectin- 1b, Itln1b ELISA KIT
ELI-39394m	Lifescience Market	96 Tests	EUR 865

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
SEA933Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1 INTL ITLN LFR HIntL Omentin Intelectin 1, Galactofuranose Binding Intestinal Lactoferrin Receptor Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
SEA933Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit
4-SEA933Ra	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1 INTL ITLN LFR HIntL Omentin Intelectin 1, Galactofuranose Binding Intestinal Lactoferrin Receptor Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit
RDR-ITLN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Mouse Intelectin 1 ELISA Kit (ITLN1)
RK02963	Abclonal	96 Tests	EUR 521

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit
RD-ITLN1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

ITLN2 ORF Vector (Human) (pORF)
ORF013395	ABM	1.0 ug DNA	EUR 354

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ELISA kit for Human ITLN1 (Intelectin 1/Omentin)
E-EL-H2028	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Human Intelectin 1 (ITLN1) CLIA Kit
20-abx492234	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Polyclonal ITLN2 Antibody (Center)
APR11252G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit
abx254237-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit
abx255780-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

ELISA kit for Mouse ITLN1 (Intelectin 1)
ELK2004	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1 Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat ITLN1 (Intelectin 1)
ELK2005	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1 Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Monkey Intelectin 1/Omentin (ITLN1) ELISA Kit
abx359483-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Intelectin 1/Omentin (ITLN1) ELISA Kit
abx361255-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit
abx362579-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Intelectin 1/Omentin (ITLN1) ELISA Kit
abx356771-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit
abx576145-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse ITLN1(Intelectin 1/Omentin) ELISA Kit
EM1180	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: O88310 Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat ITLN1(Intelectin 1/Omentin) ELISA Kit
ER1117	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

ELISA kit for Mouse Intelectin 1 (ITLN1)
KTE71460-48T	Abbkine	48T	EUR 332
Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)
KTE71460-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)
KTE71460-96T	Abbkine	96T	EUR 539
Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ITLN1 ELISA Kit| Rat Intelectin 1/Omentin ELISA Kit
EF017857	Lifescience Market	96 Tests	EUR 689

ITLN1 ELISA Kit| Mouse Intelectin 1/Omentin ELISA Kit
EF013735	Lifescience Market	96 Tests	EUR 689

ITLN2 sgRNA CRISPR Lentivector set (Human)
K1106801	ABM	3 x 1.0 ug	EUR 339

Human Intelectin 1/Omentin (ITLN1) CLIA Kit
abx195758-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Intelectin 1 (ITLN1) Protein
20-abx067298	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Mouse ITLN1 (Intelectin 1/Omentin)
E-EL-M0857	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ITLN1 (Intelectin 1/Omentin)
E-EL-R0689	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Guinea pig Intelectin 1/Omentin (ITLN1) ELISA Kit
abx357571-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1106802	ABM	1.0 ug DNA	EUR 154

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1106804	ABM	1.0 ug DNA	EUR 154

ITLN2 Protein Vector (Human) (pPB-C-His)
PV053577	ABM	500 ng	EUR 481

ITLN2 Protein Vector (Human) (pPB-N-His)
PV053578	ABM	500 ng	EUR 481

ITLN2 Protein Vector (Human) (pPM-C-HA)
PV053579	ABM	500 ng	EUR 481

ITLN2 Protein Vector (Human) (pPM-C-His)
PV053580	ABM	500 ng	EUR 481

Mouse Intelectin 1 (ITLN1) CLIA Kit
20-abx492235	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Intelectin 1 (ITLN1) CLIA Kit
20-abx492236	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

CLIA kit for Human ITLN1 (Intelectin 1/Omentin)
E-CL-H1228	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Intelectin 1 (ITLN1) Antibody
20-abx177019	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Intelectin 1 (ITLN1) Antibody
20-abx212528	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101091	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101092	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx101093	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody
20-abx172967	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Intelectin 1 (ITLN1) Antibody
20-abx172968	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Intelectin 1 (ITLN1)
4-RPA933Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8WWA0 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.4kDa Isoelectric Point: 7.2
Description: Recombinant Human Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)
4-RPA933Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O88310 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.7kDa Isoelectric Point: 8.8
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)
4-RPA933Ra01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q499T8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.4kDa Isoelectric Point: Inquire
Description: Recombinant Rat Intelectin 1 expressed in: E.coli

ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1106807	ABM	1.0 ug DNA	EUR 167

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Mouse Intelectin 1/Omentin (ITLN1) CLIA Kit
abx195759-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit