Human NXPH1(Neurexophilin 1) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Neurexophilin 1 (NXPH1) ELISA Kit

RD-NXPH1-Hu-96Tests 96 Tests
EUR 723

Human Neurexophilin 1 (NXPH1) ELISA Kit

20-abx152490
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurexophilin- 1, NXPH1 ELISA KIT

ELI-38246h 96 Tests
EUR 824

Human Neurexophilin 1(NXPH1)ELISA Kit

QY-E01643 96T
EUR 361

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

4-SEC672Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurexophilin 1 elisa. Alternative names of the recognized antigen: NPH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurexophilin 1 (NXPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

NXPH1 Human, Neurexophilin 1 Human Recombinant Protein, Sf9

PROTP58417-1 Regular: 10ug
EUR 317
Description: NXPH1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 259 amino acids (22-271) and having a molecular mass of 29.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;NXPH1 is fused to 9 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Mouse Neurexophilin- 1, Nxph1 ELISA KIT

ELI-15133m 96 Tests
EUR 865

Bovine Neurexophilin- 1, NXPH1 ELISA KIT

ELI-46103b 96 Tests
EUR 928

Rat Neurexophilin-1 (NXPH1) ELISA Kit

abx391681-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neurexophilin-1 (NXPH1) ELISA Kit

abx390007-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Neurexophilin-1 (NXPH1) Antibody

20-abx008168
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody

20-abx119118
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neurexophilin 1 (NXPH1) Antibody

20-abx128337
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurexophilin 1 (NXPH1) Antibody

20-abx173756
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurexophilin-1 (NXPH1) Antibody

abx034416-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody

abx034416-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody

abx235945-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Neurexophilin 1 (NXPH1) Antibody

20-abx328647
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody

20-abx301878
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Neurexophilin 1 (NXPH1)

4-RPC672Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P58417
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Neurexophilin 1 expressed in: E.coli

ELISA kit for Human NXPH1 (Neurexophilin 1)

ELK3869 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurexophilin 1 (NXPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurexophi
  • Show more
Description: A sandwich ELISA kit for detection of Neurexophilin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neurexophilin 1 (NXPH1) CLIA Kit

20-abx493828
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurexophilin 1 (NXPH1) Protein

20-abx166767
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nxph1 ELISA Kit| Rat Neurexophilin-1 ELISA Kit

EF019041 96 Tests
EUR 689

Nxph1 ELISA Kit| Mouse Neurexophilin-1 ELISA Kit

EF015646 96 Tests
EUR 689

NXPH1 ELISA Kit| Bovine Neurexophilin-1 ELISA Kit

EF011654 96 Tests
EUR 689

Anti-NXPH1/Neurexophilin 1 Antibody

A12696 100ul
EUR 397
Description: Anti-NXPH1 Antibody

Neurexophilin-1 (NXPH1) Antibody (HRP)

20-abx317064
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody (FITC)

20-abx317065
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody (Biotin)

20-abx317066
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human)

4-PAC672Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1)

NXPH1 Neurexophilin 1 Human Recombinant Protein

PROTP58417 Regular: 20ug
EUR 317
Description: NXPH1 Human Recombinant produced in E. coli is. a single polypeptide chain containing 273 amino acids (22-271) and having a molecular mass of 31kDa. NXPH1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-500ug 500ug
EUR 1115
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC

4-PAC672Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Biotinylated

4-PAC672Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Biotin.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Cy3

4-PAC672Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Cy3.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), FITC

4-PAC672Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with FITC.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), HRP

4-PAC672Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with HRP.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), PE

4-PAC672Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with PE.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC-Cy7

4-PAC672Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Nxph1/ Rat Nxph1 ELISA Kit

ELI-22436r 96 Tests
EUR 886

NXPH1 ELISA KIT|Human

EF001409 96 Tests
EUR 689

Anti-Neurexophilin-3 Antibody

A14597-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Neurexophilin-3 Antibody (NXPH3) detection.tested for WB in Human, Mouse, Rat.

NXPH1 ELISA Kit (Human) (OKCD00346)

OKCD00346 96 Wells
EUR 831
Description: Description of target: May be signaling molecules that resemble neuropeptides and that act by binding to alpha-neurexins and possibly other receptors.Curated ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL

NXPH1 ELISA Kit (Human) (OKDD00444)

OKDD00444 96 Wells
EUR 975
Description: Description of target: This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Neurexophilin 1 Protein

20-abx261262
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Neurexophilin- 4, NXPH4 ELISA KIT

ELI-22438h 96 Tests
EUR 824

Human Neurexophilin- 3, NXPH3 ELISA KIT

ELI-22577h 96 Tests
EUR 824

Human Neurexophilin- 2, NXPH2 ELISA KIT

ELI-44563h 96 Tests
EUR 824

Human Neurexophilin 4(NXPH4)ELISA Kit

QY-E01640 96T
EUR 361

Human Neurexophilin 3(NXPH3)ELISA Kit

QY-E01641 96T
EUR 361

Human Neurexophilin 2(NXPH2)ELISA Kit

QY-E01642 96T
EUR 361

Neurexophilin-1 Polyclonal Antibody

ABP54711-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Neurexophilin-1 Polyclonal Antibody

ABP54711-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Neurexophilin-1 Polyclonal Antibody

ABP54711-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Neurexophilin-1 Polyclonal Antibody

ES5710-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-1 Polyclonal Antibody

ES5710-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-Neurexophilin-1 antibody

STJ94423 200 µl
EUR 197
Description: Rabbit polyclonal to Neurexophilin-1.

Mouse Neurexophilin- 2, Nxph2 ELISA KIT

ELI-22437m 96 Tests
EUR 865

Mouse Neurexophilin- 3, Nxph3 ELISA KIT

ELI-22578m 96 Tests
EUR 865

Bovine Neurexophilin- 2, NXPH2 ELISA KIT

ELI-36800b 96 Tests
EUR 928

NXPH1 Antibody

DF4230 200ul
EUR 304
Description: NXPH1 Antibody detects endogenous levels of total NXPH1.

NXPH1 Antibody

1-CSB-PA016227LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NXPH1 antibody

70R-50970 100 ul
EUR 244
Description: Purified Polyclonal NXPH1 antibody

NXPH1 antibody

70R-9330 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NXPH1 antibody

NXPH1 Antibody

1-CSB-PA009085
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

NXPH1 siRNA

20-abx903719
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NXPH1 siRNA

20-abx926696
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NXPH1 siRNA

20-abx926697
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NXPH1 Antibody

ABD4230 100 ug
EUR 438

Human Neurexophilin-2 (NXPH2)

1-CSB-MP016228HU
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 31.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neurexophilin-2(NXPH2) expressed in Mammalian cell

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human NXPH1 shRNA Plasmid

20-abx959332
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NXPH1 Recombinant Protein (Human)

RP021991 100 ug Ask for price

Neurexophilin 4 antibody

70R-4049 50 ug
EUR 467
Description: Rabbit polyclonal Neurexophilin 4 antibody raised against the N terminal of NXPH4

Neurexophilin 3 antibody

70R-4470 50 ug
EUR 467
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the N terminal of NXPH3

Neurexophilin 3 antibody

70R-4471 50 ug
EUR 467
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the middle region of NXPH3

anti-Neurexophilin 3

YF-PA17541 50 ug
EUR 363
Description: Mouse polyclonal to Neurexophilin 3

NXPH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1471602 1.0 ug DNA
EUR 154

Nxph1 Blocking Peptide

33R-5184 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Nxph1 antibody, catalog no. 70R-9330

NXPH1 Blocking Peptide

DF4230-BP 1mg
EUR 195

NXPH1 Blocking Peptide

20-abx063845
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NXPH1 cloning plasmid

CSB-CL016227HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 816
  • Sequence: atgcaggctgcgtgctggtacgtgcttttcctcctgcagcccaccgtctacttggtcacatgtgccaatttaacgaacggtggaaagtcagaacttctgaaatcaggaagcagcaaatccacactaaagcacatatggacagaaagcagcaaagacttgtctatcagccgactcct
  • Show more
Description: A cloning plasmid for the NXPH1 gene.

anti- NXPH1 antibody

FNab05945 100µg
EUR 548.75
  • Immunogen: neurexophilin 1
  • Uniprot ID: P58417
  • Gene ID: 30010
  • Research Area: Neuroscience
Description: Antibody raised against NXPH1

Anti-NXPH1 antibody

PAab05945 100 ug
EUR 386

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

NXPH1 ORF Vector (Human) (pORF)

ORF007331 1.0 ug DNA
EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Neurexophilin 3 Blocking Peptide

33R-7840 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4470

Neurexophilin 4 Blocking Peptide

33R-6369 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH4 antibody, catalog no. 70R-4049

Neurexophilin 3 Blocking Peptide

33R-6733 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4471

Neurexophilin-2 (NXPH2) Antibody

20-abx008273
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

abx026137-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

abx026137-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody

20-abx217298
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

20-abx133519
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

20-abx014651
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

20-abx014652
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

abx029138-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

abx029138-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human NXPH1(Neurexophilin 1) ELISA Kit