D609 PC-PLC inhibitor 

To Order Contact us: stephen@expresspharmapulse.com


HY-70072 10mM/1mL
EUR 126

Human Pyruvate Carboxylase (PC) ELISA Kit

DLR-PC-Hu-48T 48T
EUR 517
  • Should the Human Pyruvate Carboxylase (PC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pyruvate Carboxylase (PC) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Pyruvate Carboxylase (PC) ELISA Kit

DLR-PC-Hu-96T 96T
EUR 673
  • Should the Human Pyruvate Carboxylase (PC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Pyruvate Carboxylase (PC) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Pyruvate Carboxylase (PC) ELISA Kit

DLR-PC-Mu-48T 48T
EUR 527
  • Should the Mouse Pyruvate Carboxylase (PC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Pyruvate Carboxylase (PC) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Pyruvate Carboxylase (PC) ELISA Kit

DLR-PC-Mu-96T 96T
EUR 688
  • Should the Mouse Pyruvate Carboxylase (PC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Pyruvate Carboxylase (PC) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Pyruvate Carboxylase (PC) ELISA Kit

RDR-PC-Hu-48Tests 48 Tests
EUR 544

Human Pyruvate Carboxylase (PC) ELISA Kit

RDR-PC-Hu-96Tests 96 Tests
EUR 756

Mouse Pyruvate Carboxylase (PC) ELISA Kit

RDR-PC-Mu-48Tests 48 Tests
EUR 557

Mouse Pyruvate Carboxylase (PC) ELISA Kit

RDR-PC-Mu-96Tests 96 Tests
EUR 774

Human Pyruvate Carboxylase (PC) ELISA Kit

RD-PC-Hu-48Tests 48 Tests
EUR 521

Human Pyruvate Carboxylase (PC) ELISA Kit

RD-PC-Hu-96Tests 96 Tests
EUR 723

Mouse Pyruvate Carboxylase (PC) ELISA Kit

RD-PC-Mu-48Tests 48 Tests
EUR 533

Mouse Pyruvate Carboxylase (PC) ELISA Kit

RD-PC-Mu-96Tests 96 Tests
EUR 740


EF007093 96 Tests
EUR 689


EF007094 96 Tests
EUR 689


ABF5854 100 ug
EUR 438


ELA-E1596r 96 Tests
EUR 886

Phospho- PLC-

ABF5852 100 ug
EUR 438

Phospho- PLC-

ABF5853 100 ug
EUR 438

Phospho- PLC

ABF3704 100 ug
EUR 438

PC Antibody

31111-100ul 100ul
EUR 252

PC Antibody

31111-50ul 50ul
EUR 187

PC antibody

70R-19133 50 ul
EUR 435
Description: Rabbit polyclonal PC antibody

PC Antibody

34943-100ul 100ul
EUR 252

PC Antibody

34943-50ul 50ul
EUR 187

PC antibody

38807-100ul 100ul
EUR 252

PC Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PC. Recognizes PC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PC Antibody

DF4364 200ul
EUR 304
Description: PC Antibody detects endogenous levels of total PC.

PC Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PC. Recognizes PC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PC Antibody

CSB-PA587753-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PC. Recognizes PC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PC Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PC. Recognizes PC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PC Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PC. Recognizes PC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PC Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PC. Recognizes PC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PC antibody

70R-9828 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PC antibody


C4894-10 10 mg
EUR 295
Description: Thioetheramide-PC is a competitive, reversible inhibitor of secretory phospholipase A2 (sPLA2) [1]. Thioetheramide-PC is a structurally modified phospholipid.


C4894-25 25 mg
EUR 586
Description: Thioetheramide-PC is a competitive, reversible inhibitor of secretory phospholipase A2 (sPLA2) [1]. Thioetheramide-PC is a structurally modified phospholipid.


C4894-5 5 mg
EUR 187
Description: Thioetheramide-PC is a competitive, reversible inhibitor of secretory phospholipase A2 (sPLA2) [1]. Thioetheramide-PC is a structurally modified phospholipid.


C4269-1 1 mg
EUR 363
Description: PC-766B is a macrolide antibiotic existed in anactinomycete strain SC-4710. PC-766B was active against Gram-positive bacteria, and some fungi and yeasts, yet inactive against Gram-negative bacteria. PC-766B exhibited potent cytotoxicity against murine tumor cell lines in vitro.


C4269-5 5 mg
EUR 1224
Description: PC-766B is a macrolide antibiotic existed in anactinomycete strain SC-4710. PC-766B was active against Gram-positive bacteria, and some fungi and yeasts, yet inactive against Gram-negative bacteria. PC-766B exhibited potent cytotoxicity against murine tumor cell lines in vitro.

PC Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PC. Recognizes PC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PC Antibody

ABD4364 100 ug
EUR 438


P073-1MG 1 mg
EUR 272


P073-5MG 5 mg
EUR 878

PLC beta antibody

70R-31038 100 ug
EUR 327
Description: Rabbit polyclonal PLC beta antibody

PLC gamma antibody

70R-37567 100 ug
EUR 273
Description: Rabbit Polyclonal PLC gamma antibody

PC Blocking Peptide

33R-8614 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PC antibody, catalog no. 70R-9828

PC Blocking Peptide

DF4364-BP 1mg
EUR 195

PC-3 cells

C0019002 One Frozen vial
EUR 455

PC-12 cells

C0032001 One Frozen vial
EUR 455

PC-12adh cells

C0032002 One Frozen vial
EUR 455

PC Conjugated Antibody

C34943 100ul
EUR 397

PC Conjugated Antibody

C31111 100ul
EUR 397

PC cloning plasmid

CSB-CL017511HU-10ug 10ug
EUR 1252
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3537
  • Sequence: atgctgaagttccgaacagtccatgggggcctgaggctcctgggaatccgccgaacctccaccgcccccgctgcctccccaaatgtccggcgcctggagtataagcccatcaagaaagtcatggtggccaacagaggtgagattgccatccgtgtgttccgggcctgcacggagc
  • Show more
Description: A cloning plasmid for the PC gene.

PC Rabbit pAb

A6301-100ul 100 ul
EUR 308

PC Rabbit pAb

A6301-200ul 200 ul
EUR 459

PC Rabbit pAb

A6301-20ul 20 ul
EUR 183

PC Rabbit pAb

A6301-50ul 50 ul
EUR 223

Anti-PC antibody

STJ28223 100 µl
EUR 277
Description: This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene.

PLC gamma 1 Antibody

29227-100ul 100ul
EUR 252

PLC gamma 2 Antibody

29229-100ul 100ul
EUR 252

PLC gamma 2 antibody

70R-11929 100 ug
EUR 447
Description: Rabbit polyclonal PLC gamma 2 antibody

PLC gamma 2 antibody

70R-11930 100 ug
EUR 403
Description: Rabbit polyclonal PLC gamma 2 antibody

PLC gamma 2 antibody

70R-12024 100 ug
EUR 403
Description: Rabbit polyclonal PLC gamma 2 antibody

PLC beta antibody (Ser1105)

70R-31037 100 ug
EUR 327
Description: Rabbit polyclonal PLC beta antibody (Ser1105)

PLC gamma 2 Antibody

EUR 338

D609 PC-PLC inhibitor