Human NF2(Neurofibromin 2) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Neurofibromin 2 (NF2) ELISA Kit

RD-NF2-Hu-96Tests 96 Tests
EUR 692

Human Neurofibromin 2 (NF2) ELISA Kit

20-abx152493
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human NF2(Neurofibromin 2) ELISA Kit

EH10524 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P35240
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Neurofibromin 2 (NF2) ELISA Kit

SEB946Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit

SEB946Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit

SEB946Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit

SEB946Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit

4-SEB946Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurofibromin 2 elisa. Alternative names of the recognized antigen: ACN
  • BANF
  • SCH
  • Merlin
  • Bilateral Acoustic Neuroma
  • Schwannomin
  • Schwannomerlin
  • Moesin-Ezrin-Radixin-Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurofibromin 2 (NF2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Neurofibromin 2 (NF2) Antibody

20-abx101230
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurofibromin 2 (NF2) Antibody

20-abx101231
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurofibromin 2 (NF2) Antibody

20-abx173763
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurofibromin 2 (NF2) Antibody

abx235684-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Neurofibromin 2 (NF2) Antibody

abx235685-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Neurofibromin 2 (NF2) Antibody

abx332085-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Neurofibromin 2 (NF2) Antibody

abx433023-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Recombinant Neurofibromin 2 (NF2)

4-RPB946Hu01
  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P35240
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.6kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Neurofibromin 2 expressed in: E.coli

Recombinant Neurofibromin 2 (NF2)

4-RPB946Mu01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P46662
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.3kDa
  • Isoelectric Point: 6.5
Description: Recombinant Mouse Neurofibromin 2 expressed in: E.coli

ELISA kit for Human NF2 (Neurofibromin 2)

ELK3708 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurofibromin 2 (NF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurofibromi
  • Show more
Description: A sandwich ELISA kit for detection of Neurofibromin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neurofibromin 2 (NF2) CLIA Kit

20-abx493281
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurofibromin 2 (NF2) Protein

20-abx068243
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Neurofibromin 2 (NF2) Protein

20-abx068242
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human)

4-PAB946Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2)

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse)

4-PAB946Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2)

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), APC

4-PAB946Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with APC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), Biotinylated

4-PAB946Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with Biotin.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), Cy3

4-PAB946Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with Cy3.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), FITC

4-PAB946Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with FITC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), HRP

4-PAB946Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with HRP.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), PE

4-PAB946Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with PE.

Neurofibromin 2 Phospho-Ser10 (NF2 pS10) Antibody

20-abx329030
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurofibromin 2 Phospho-Ser518 (NF2 pS518) Antibody

20-abx329605
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurofibromin 2 Phospho-Ser518 (NF2 pS518) Antibody

abx333131-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), APC

4-PAB946Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with APC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), Biotinylated

4-PAB946Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with Biotin.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), Cy3

4-PAB946Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with Cy3.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), FITC

4-PAB946Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with FITC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), HRP

4-PAB946Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with HRP.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), PE

4-PAB946Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with PE.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), APC-Cy7

4-PAB946Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Leu239)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with APC-Cy7.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB946Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NF2 (Asp30~Arg311)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with APC-Cy7.

Nf2/ Rat Nf2 ELISA Kit

ELI-20477r 96 Tests
EUR 886

Anti-NF2/Merlin Antibody

A00279-2 100ug/vial
EUR 334

Human Neurofibromin (NF1) ELISA Kit

abx251745-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human NF1(Neurofibromin) ELISA Kit

EH2385 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P21359
  • Alias: NF1/Neurofibromatosis-related protein NF-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Human Neurofibromin

EK4795 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neurofibromin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NF1/ Neurofibromin ELISA Kit

E1734Hu 1 Kit
EUR 605

Human Neurofibromin, NF1 ELISA KIT

ELI-13821h 96 Tests
EUR 824

NF2 ELISA KIT|Human

EF001195 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Neurofibromin 2 (Merlin) Antibody

20-abx114069
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Merlin, NF2 ELISA KIT

ELI-14011h 96 Tests
EUR 824

NF2 ELISA Kit (Human) (OKCD00852)

OKCD00852 96 Wells
EUR 792
Description: Description of target: Probable regulator of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway, a signaling pathway that plays a pivotal role in tumor suppression by restricting proliferation and promoting apoptosis. Along with WWC1 can synergistically induce the phosphorylation of LATS1 and LATS2 and can probably function in the regulation of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway. May act as a membrane stabilizing protein. May inhibit PI3 kinase by binding to AGAP2 and impairing its stimulating activity. Suppresses cell proliferation and tumorigenesis by inhibiting the CUL4A-RBX1-DDB1-VprBP/DCAF1 E3 ubiquitin-protein ligase complex.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.18"Merlin/NF2 suppresses tumorigenesis by inhibiting the E3 ubiquitin ligase CRL4(DCAF1) in the nucleus."_x005F_x005F_x000D_Li W., You L., Cooper J., Schiavon G., Pepe-Caprio A., Zhou L., Ishii R., Giovannini M., Hanemann C.O., Long S.B., Erdjument-Bromage H., Zhou P., Tempst P., Giancotti F.G._x005F_x005F_x000D_Cell 140:477-490(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH VPRBP AND THE CUL4A-RBX1-DDB1-VPRBP/DCAF1 E3 UBIQUITIN-PROTEIN LIGASE COMPLEX, PHOSPHORYLATION, MUTAGENESIS OF LEU-64 AND SER-518, CHARACTERIZATION OF VARIANT ARG-46, CHARACTERIZATION OF VARIANTS NF2 SER-62 AND PRO-141.Ref.19"Kibra functions as a tumor suppressor protein that regulates Hippo signaling in conjunction with Merlin and Expanded."_x005F_x005F_x000D_Yu J., Zheng Y., Dong J., Klusza S., Deng W.-M., Pan D._x005F_x005F_x000D_Dev. Cell 18:288-299(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL

pOTB7-NF2-2

PVT18312 2 ug
EUR 231

Mouse Nf1/ Neurofibromin ELISA Kit

E1019Mo 1 Kit
EUR 632

Mouse Neurofibromin, Nf1 ELISA KIT

ELI-13822m 96 Tests
EUR 865

Chicken Neurofibromin, NF1 ELISA KIT

ELI-45672c 96 Tests
EUR 928

Chicken Neurofibromin (NF1) ELISA Kit

abx520732-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neurofibromin (NF1) ELISA Kit

abx520734-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Neurofibromin (NF1) ELISA Kit

abx520735-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Nf1 ELISA Kit| Rat Neurofibromin ELISA Kit

EF019046 96 Tests
EUR 689

Nf1 ELISA Kit| Mouse Neurofibromin ELISA Kit

EF015654 96 Tests
EUR 689

NF1 ELISA Kit| chicken Neurofibromin ELISA Kit

EF012421 96 Tests
EUR 689

Neurofibromin Antibody

PAab09869 100 ug
EUR 386

anti-Neurofibromin

YF-PA24232 50 ul
EUR 334
Description: Mouse polyclonal to Neurofibromin

Anti-Neurofibromin 2 (Zebrafish) antibody

STJ71257 100 µg
EUR 359

Mouse Merlin, Nf2 ELISA KIT

ELI-46083m 96 Tests
EUR 865

Rat Merlin (NF2) ELISA Kit

abx391687-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Merlin (NF2) ELISA Kit

abx390016-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Merlin (NF2)

1-CSB-EP015741HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Merlin(NF2) expressed in E.coli

Nf2 ELISA Kit| Rat Merlin ELISA Kit

EF019047 96 Tests
EUR 689

Nf2 ELISA Kit| Mouse Merlin ELISA Kit

EF015655 96 Tests
EUR 689

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Anti-Neurofibromin Antibody

A00043 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Neurofibromin Antibody (NF1) detection.tested for WB in Human, Mouse, Rat.

Neurofibromin (NF1) Antibody

20-abx008941
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody

20-abx014052
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody

20-abx328115
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody

20-abx334060
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurofibromin Polyclonal Antibody

ABP51931-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600
  • Applications tips:
Description: A polyclonal antibody for detection of Neurofibromin from Human, Mouse, Rat. This Neurofibromin antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600

Neurofibromin Polyclonal Antibody

ABP51931-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600
  • Applications tips:
Description: A polyclonal antibody for detection of Neurofibromin from Human, Mouse, Rat. This Neurofibromin antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600

Neurofibromin Polyclonal Antibody

ABP51931-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600
  • Applications tips:
Description: A polyclonal antibody for detection of Neurofibromin from Human, Mouse, Rat. This Neurofibromin antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600

Neurofibromin Polyclonal Antibody

ES2930-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neurofibromin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Neurofibromin Polyclonal Antibody

ES2930-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neurofibromin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

anti- Neurofibromin Antibody

FNab09869 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:1000
  • IHC: 1:50 - 1:500
  • IF: 1:50 - 1:500
  • Immunogen: Neurofibromin
  • Uniprot ID: P21359
  • Gene ID: 4763
  • Research Area: Signal Transduction, Neuroscience, Cancer, Metabolism
Description: Antibody raised against Neurofibromin

anti- Neurofibromin Antibody

LSMab09869 100 ug
EUR 386

Anti-Neurofibromin antibody

STJ94430 200 µl
EUR 197
Description: Rabbit polyclonal to Neurofibromin.

Anti-Neurofibromin (2D1)

YF-MA14423 100 ug
EUR 363
Description: Mouse monoclonal to Neurofibromin

NF2 antibody

70R-18852 50 ul
EUR 435
Description: Rabbit polyclonal NF2 antibody

NF2 antibody

38403-100ul 100ul
EUR 252

NF2 Antibody

1-CSB-PA003420
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

NF2 Antibody

CSB-PA249373-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

NF2 Antibody

CSB-PA249373-100ul 100ul
EUR 314
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

NF2 Antibody

1-CSB-PA015741GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NF2 Antibody

1-CSB-PA015741LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NF2 Antibody

1-CSB-PA020077
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NF2 siRNA

20-abx903540
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NF2 siRNA

20-abx925790
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NF2 siRNA

20-abx925791
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0011603 1.0 ug DNA
EUR 154

Human NF2 shRNA Plasmid

20-abx953164
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NF2 Recombinant Protein (Human)

RP021103 100 ug Ask for price

NF2 Recombinant Protein (Human)

RP021106 100 ug Ask for price

Anti-Neurofibromin/NF1 Antibody

A00043-1 100ug/vial
EUR 334

Neurofibromin (NF1) Antibody (HRP)

20-abx336754
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody (FITC)

20-abx336755
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody (Biotin)

20-abx336756
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

NF2 Rabbit pAb

A13626-100ul 100 ul
EUR 308

NF2 Rabbit pAb

A13626-200ul 200 ul
EUR 459

NF2 Rabbit pAb

A13626-20ul 20 ul
EUR 183

NF2 Rabbit pAb

A13626-50ul 50 ul
EUR 223

NF2 Polyclonal Antibody

41220-100ul 100ul
EUR 252

NF2 Polyclonal Antibody

41220-50ul 50ul
EUR 187

Mouse Merlin (Nf2)

1-CSB-EP015741MO1
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Merlin(Nf2),partial expressed in E.coli

NF2 Polyclonal Antibody

ABP55366-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S10
  • Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S10

NF2 Polyclonal Antibody

ABP55366-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S10
  • Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S10

NF2 Polyclonal Antibody

ABP55366-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S10
  • Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S10

NF2 Conjugated Antibody

C38403 100ul
EUR 397

Merlin (NF2) Antibody

20-abx329332
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Merlin (NF2) Antibody

abx332246-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Merlin (NF2) Antibody

20-abx327403
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Merlin (NF2) Antibody

20-abx318016
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NF2 cloning plasmid

CSB-CL015741HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 249
  • Sequence: atggtggtttcattacgagcccttctgctggctctcaggcagaagccccacagcaccgggaccattcatgaggtcactgcccagctcatgatgtccgtgaggctgtccttttggccagtagccgtgtgcagctgtgtggcacagatggcttcgttcatcctgatcaaggccccacc
  • Show more
Description: A cloning plasmid for the NF2 gene.

NF2 cloning plasmid

CSB-CL015741HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1524
  • Sequence: atggccggggccatcgcttcccgcatgagcttcagctctctcaagaggaagcaacccaagacgttcaccgtgaggatcgtcaccatggacgccgagatggagttcaattgcgaggtaaagaagcagattttagatgaaaagatctactgccctcctgaggcttctgtgctcctgg
  • Show more
Description: A cloning plasmid for the NF2 gene.

NF2 Polyclonal Antibody

ABP51937-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S518
  • Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S518

NF2 Polyclonal Antibody

ABP51937-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S518
  • Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S518

NF2 Polyclonal Antibody

ABP51937-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S518
  • Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S518

NF2 Rabbit pAb

A2456-100ul 100 ul
EUR 308

NF2 Rabbit pAb

A2456-200ul 200 ul
EUR 459

NF2 Rabbit pAb

A2456-20ul 20 ul
EUR 183

NF2 Rabbit pAb

A2456-50ul 50 ul
EUR 223

NF2 (pS518) Antibody

20-abx000461
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Merlin (NF2) Antibody

20-abx001917
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NF2 Polyclonal Antibody

ES2936-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NF2 Polyclonal Antibody

ES2936-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NF2 Polyclonal Antibody

ES6365-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NF2 Polyclonal Antibody

ES6365-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- NF2 antibody

FNab05684 100µg
EUR 505.25
  • Immunogen: neurofibromin 2(merlin)
  • Uniprot ID: P35240
  • Gene ID: 4771
  • Research Area: Stem Cells
Description: Antibody raised against NF2

Human NF2(Neurofibromin 2) ELISA Kit