Human NF2(Neurofibromin 2) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Neurofibromin 2 (NF2) ELISA Kit
RD-NF2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Neurofibromin 2 (NF2) ELISA Kit
20-abx152493	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human NF2(Neurofibromin 2) ELISA Kit
EH10524	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml Uniprot ID: P35240
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Neurofibromin 2 (NF2) ELISA Kit
SEB946Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit
SEB946Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit
SEB946Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit
SEB946Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurofibromin 2 (NF2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurofibromin 2 (NF2) in Tissue homogenates and other biological fluids.

Human Neurofibromin 2 (NF2) ELISA Kit
4-SEB946Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neurofibromin 2 elisa. Alternative names of the recognized antigen: ACN BANF SCH Merlin Bilateral Acoustic Neuroma Schwannomin Schwannomerlin Moesin-Ezrin-Radixin-Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurofibromin 2 (NF2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Neurofibromin 2 (NF2) Antibody
20-abx101230	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neurofibromin 2 (NF2) Antibody
20-abx101231	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neurofibromin 2 (NF2) Antibody
20-abx173763	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Neurofibromin 2 (NF2) Antibody
abx235684-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Neurofibromin 2 (NF2) Antibody
abx235685-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Neurofibromin 2 (NF2) Antibody
abx332085-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Neurofibromin 2 (NF2) Antibody
abx433023-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Recombinant Neurofibromin 2 (NF2)
4-RPB946Hu01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P35240 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.6kDa Isoelectric Point: 5.7
Description: Recombinant Human Neurofibromin 2 expressed in: E.coli

Recombinant Neurofibromin 2 (NF2)
4-RPB946Mu01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P46662 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.3kDa Isoelectric Point: 6.5
Description: Recombinant Mouse Neurofibromin 2 expressed in: E.coli

ELISA kit for Human NF2 (Neurofibromin 2)
ELK3708	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurofibromin 2 (NF2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurofibromi Show more
Description: A sandwich ELISA kit for detection of Neurofibromin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neurofibromin 2 (NF2) CLIA Kit
20-abx493281	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Neurofibromin 2 (NF2) Protein
20-abx068243	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Neurofibromin 2 (NF2) Protein
20-abx068242	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human)
4-PAB946Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2)

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse)
4-PAB946Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2)

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), APC
4-PAB946Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with APC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), Biotinylated
4-PAB946Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with Biotin.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), Cy3
4-PAB946Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with Cy3.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), FITC
4-PAB946Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with FITC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), HRP
4-PAB946Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with HRP.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), PE
4-PAB946Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with PE.

Neurofibromin 2 Phospho-Ser10 (NF2 pS10) Antibody
20-abx329030	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurofibromin 2 Phospho-Ser518 (NF2 pS518) Antibody
20-abx329605	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurofibromin 2 Phospho-Ser518 (NF2 pS518) Antibody
abx333131-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), APC
4-PAB946Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with APC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), Biotinylated
4-PAB946Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with Biotin.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), Cy3
4-PAB946Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with Cy3.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), FITC
4-PAB946Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with FITC.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), HRP
4-PAB946Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with HRP.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), PE
4-PAB946Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with PE.

Neurofibromin 2 (NF2) Polyclonal Antibody (Human), APC-Cy7
4-PAB946Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Leu239) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Neurofibromin 2 (NF2). This antibody is labeled with APC-Cy7.

Neurofibromin 2 (NF2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB946Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NF2 (Asp30~Arg311) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Neurofibromin 2 (NF2). This antibody is labeled with APC-Cy7.

Nf2/ Rat Nf2 ELISA Kit
ELI-20477r	Lifescience Market	96 Tests	EUR 886

Anti-NF2/Merlin Antibody
A00279-2	BosterBio	100ug/vial	EUR 334

Human Neurofibromin (NF1) ELISA Kit
abx251745-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human NF1(Neurofibromin) ELISA Kit
EH2385	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P21359 Alias: NF1/Neurofibromatosis-related protein NF-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Human Neurofibromin
EK4795	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neurofibromin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human NF1/ Neurofibromin ELISA Kit
E1734Hu	Sunlong	1 Kit	EUR 605

Human Neurofibromin, NF1 ELISA KIT
ELI-13821h	Lifescience Market	96 Tests	EUR 824

NF2 ELISA KIT|Human
EF001195	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Neurofibromin 2 (Merlin) Antibody
20-abx114069	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Human Merlin, NF2 ELISA KIT
ELI-14011h	Lifescience Market	96 Tests	EUR 824

NF2 ELISA Kit (Human) (OKCD00852)
OKCD00852	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Probable regulator of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway, a signaling pathway that plays a pivotal role in tumor suppression by restricting proliferation and promoting apoptosis. Along with WWC1 can synergistically induce the phosphorylation of LATS1 and LATS2 and can probably function in the regulation of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway. May act as a membrane stabilizing protein. May inhibit PI3 kinase by binding to AGAP2 and impairing its stimulating activity. Suppresses cell proliferation and tumorigenesis by inhibiting the CUL4A-RBX1-DDB1-VprBP/DCAF1 E3 ubiquitin-protein ligase complex.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.18"Merlin/NF2 suppresses tumorigenesis by inhibiting the E3 ubiquitin ligase CRL4(DCAF1) in the nucleus."_x005F_x005F_x000D_Li W., You L., Cooper J., Schiavon G., Pepe-Caprio A., Zhou L., Ishii R., Giovannini M., Hanemann C.O., Long S.B., Erdjument-Bromage H., Zhou P., Tempst P., Giancotti F.G._x005F_x005F_x000D_Cell 140:477-490(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH VPRBP AND THE CUL4A-RBX1-DDB1-VPRBP/DCAF1 E3 UBIQUITIN-PROTEIN LIGASE COMPLEX, PHOSPHORYLATION, MUTAGENESIS OF LEU-64 AND SER-518, CHARACTERIZATION OF VARIANT ARG-46, CHARACTERIZATION OF VARIANTS NF2 SER-62 AND PRO-141.Ref.19"Kibra functions as a tumor suppressor protein that regulates Hippo signaling in conjunction with Merlin and Expanded."_x005F_x005F_x000D_Yu J., Zheng Y., Dong J., Klusza S., Deng W.-M., Pan D._x005F_x005F_x000D_Dev. Cell 18:288-299(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL

pOTB7-NF2-2
PVT18312	Lifescience Market	2 ug	EUR 231

Mouse Nf1/ Neurofibromin ELISA Kit
E1019Mo	Sunlong	1 Kit	EUR 632

Mouse Neurofibromin, Nf1 ELISA KIT
ELI-13822m	Lifescience Market	96 Tests	EUR 865

Chicken Neurofibromin, NF1 ELISA KIT
ELI-45672c	Lifescience Market	96 Tests	EUR 928

Chicken Neurofibromin (NF1) ELISA Kit
abx520732-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Neurofibromin (NF1) ELISA Kit
abx520734-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Neurofibromin (NF1) ELISA Kit
abx520735-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Nf1 ELISA Kit| Rat Neurofibromin ELISA Kit
EF019046	Lifescience Market	96 Tests	EUR 689

Nf1 ELISA Kit| Mouse Neurofibromin ELISA Kit
EF015654	Lifescience Market	96 Tests	EUR 689

NF1 ELISA Kit| chicken Neurofibromin ELISA Kit
EF012421	Lifescience Market	96 Tests	EUR 689

Neurofibromin Antibody
PAab09869	Lifescience Market	100 ug	EUR 386

anti-Neurofibromin
YF-PA24232	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Neurofibromin

Anti-Neurofibromin 2 (Zebrafish) antibody
STJ71257	St John's Laboratory	100 µg	EUR 359

Mouse Merlin, Nf2 ELISA KIT
ELI-46083m	Lifescience Market	96 Tests	EUR 865

Rat Merlin (NF2) ELISA Kit
abx391687-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Merlin (NF2) ELISA Kit
abx390016-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Merlin (NF2)
1-CSB-EP015741HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 73.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Merlin(NF2) expressed in E.coli

Nf2 ELISA Kit| Rat Merlin ELISA Kit
EF019047	Lifescience Market	96 Tests	EUR 689

Nf2 ELISA Kit| Mouse Merlin ELISA Kit
EF015655	Lifescience Market	96 Tests	EUR 689

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Anti-Neurofibromin Antibody
A00043	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Neurofibromin Antibody (NF1) detection.tested for WB in Human, Mouse, Rat.

Neurofibromin (NF1) Antibody
20-abx008941	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody
20-abx014052	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody
20-abx328115	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody
20-abx334060	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurofibromin Polyclonal Antibody
ABP51931-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600 Applications tips:
Description: A polyclonal antibody for detection of Neurofibromin from Human, Mouse, Rat. This Neurofibromin antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600

Neurofibromin Polyclonal Antibody
ABP51931-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600 Applications tips:
Description: A polyclonal antibody for detection of Neurofibromin from Human, Mouse, Rat. This Neurofibromin antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600

Neurofibromin Polyclonal Antibody
ABP51931-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600 Applications tips:
Description: A polyclonal antibody for detection of Neurofibromin from Human, Mouse, Rat. This Neurofibromin antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurofibromin at AA range: 1520-1600

Neurofibromin Polyclonal Antibody
ES2930-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neurofibromin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Neurofibromin Polyclonal Antibody
ES2930-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neurofibromin from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

anti- Neurofibromin Antibody
FNab09869	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:1000 IHC: 1:50 - 1:500 IF: 1:50 - 1:500 Immunogen: Neurofibromin Uniprot ID: P21359 Gene ID: 4763 Research Area: Signal Transduction, Neuroscience, Cancer, Metabolism
Description: Antibody raised against Neurofibromin

anti- Neurofibromin Antibody
LSMab09869	Lifescience Market	100 ug	EUR 386

Anti-Neurofibromin antibody
STJ94430	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Neurofibromin.

Anti-Neurofibromin (2D1)
YF-MA14423	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Neurofibromin

NF2 antibody
70R-18852	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NF2 antibody

NF2 antibody
38403-100ul	SAB	100ul	EUR 252

NF2 Antibody
1-CSB-PA003420	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

NF2 Antibody
CSB-PA249373-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

NF2 Antibody
CSB-PA249373-100ul	Cusabio	100ul	EUR 314
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

NF2 Antibody
1-CSB-PA015741GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NF2 Antibody
1-CSB-PA015741LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NF2 Antibody
1-CSB-PA020077	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NF2. Recognizes NF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NF2 siRNA
20-abx903540	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NF2 siRNA
20-abx925790	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NF2 siRNA
20-abx925791	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0011603	ABM	1.0 ug DNA	EUR 154

Human NF2 shRNA Plasmid
20-abx953164	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NF2 Recombinant Protein (Human)
RP021103	ABM	100 ug	Ask for price

NF2 Recombinant Protein (Human)
RP021106	ABM	100 ug	Ask for price

Anti-Neurofibromin/NF1 Antibody
A00043-1	BosterBio	100ug/vial	EUR 334

Neurofibromin (NF1) Antibody (HRP)
20-abx336754	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody (FITC)
20-abx336755	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neurofibromin (NF1) Antibody (Biotin)
20-abx336756	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

NF2 Rabbit pAb
A13626-100ul	Abclonal	100 ul	EUR 308

NF2 Rabbit pAb
A13626-200ul	Abclonal	200 ul	EUR 459

NF2 Rabbit pAb
A13626-20ul	Abclonal	20 ul	EUR 183

NF2 Rabbit pAb
A13626-50ul	Abclonal	50 ul	EUR 223

NF2 Polyclonal Antibody
41220-100ul	SAB	100ul	EUR 252

NF2 Polyclonal Antibody
41220-50ul	SAB	50ul	EUR 187

Mouse Merlin (Nf2)
1-CSB-EP015741MO1	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Merlin(Nf2),partial expressed in E.coli

NF2 Polyclonal Antibody
ABP55366-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S10 Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S10

NF2 Polyclonal Antibody
ABP55366-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S10 Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S10

NF2 Polyclonal Antibody
ABP55366-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S10 Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S10

NF2 Conjugated Antibody
C38403	SAB	100ul	EUR 397

Merlin (NF2) Antibody
20-abx329332	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Merlin (NF2) Antibody
abx332246-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Merlin (NF2) Antibody
20-abx327403	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Merlin (NF2) Antibody
20-abx318016	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NF2 cloning plasmid
CSB-CL015741HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 249 Sequence: atggtggtttcattacgagcccttctgctggctctcaggcagaagccccacagcaccgggaccattcatgaggtcactgcccagctcatgatgtccgtgaggctgtccttttggccagtagccgtgtgcagctgtgtggcacagatggcttcgttcatcctgatcaaggccccacc Show more
Description: A cloning plasmid for the NF2 gene.

NF2 cloning plasmid
CSB-CL015741HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1524 Sequence: atggccggggccatcgcttcccgcatgagcttcagctctctcaagaggaagcaacccaagacgttcaccgtgaggatcgtcaccatggacgccgagatggagttcaattgcgaggtaaagaagcagattttagatgaaaagatctactgccctcctgaggcttctgtgctcctgg Show more
Description: A cloning plasmid for the NF2 gene.

NF2 Polyclonal Antibody
ABP51937-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S518 Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S518

NF2 Polyclonal Antibody
ABP51937-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S518 Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S518

NF2 Polyclonal Antibody
ABP51937-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human NF2 around the non-phosphorylation site of S518 Applications tips:
Description: A polyclonal antibody for detection of NF2 from Human, Mouse, Rat. This NF2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human NF2 around the non-phosphorylation site of S518

NF2 Rabbit pAb
A2456-100ul	Abclonal	100 ul	EUR 308

NF2 Rabbit pAb
A2456-200ul	Abclonal	200 ul	EUR 459

NF2 Rabbit pAb
A2456-20ul	Abclonal	20 ul	EUR 183

NF2 Rabbit pAb
A2456-50ul	Abclonal	50 ul	EUR 223

NF2 (pS518) Antibody
20-abx000461	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Merlin (NF2) Antibody
20-abx001917	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

NF2 Polyclonal Antibody
ES2936-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NF2 Polyclonal Antibody
ES2936-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

NF2 Polyclonal Antibody
ES6365-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NF2 Polyclonal Antibody
ES6365-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- NF2 antibody
FNab05684	FN Test	100µg	EUR 505.25
Immunogen: neurofibromin 2(merlin) Uniprot ID: P35240 Gene ID: 4771 Research Area: Stem Cells
Description: Antibody raised against NF2

Human NF2(Neurofibromin 2) ELISA Kit