Histoclear 1 gal 

To Order Contact us: stephen@expresspharmapulse.com

Human Galanin (GAL) ELISA Kit

RD-GAL-Hu-96Tests 96 Tests
EUR 692

Rat Galanin (GAL) ELISA Kit

RD-GAL-Ra-48Tests 48 Tests
EUR 534

Rat Galanin (GAL) ELISA Kit

RD-GAL-Ra-96Tests 96 Tests
EUR 742

Human Galanin (GAL) ELISA Kit

RDR-GAL-Hu-48Tests 48 Tests
EUR 522

Human Galanin (GAL) ELISA Kit

RDR-GAL-Hu-96Tests 96 Tests
EUR 724

Rat Galanin (GAL) ELISA Kit

RDR-GAL-Ra-48Tests 48 Tests
EUR 558

Rat Galanin (GAL) ELISA Kit

RDR-GAL-Ra-96Tests 96 Tests
EUR 776

Human Galectin-3 (Gal-3) AssayMax ELISA Kit

EG3311-1 96 Well Plate
EUR 477

Human Galectin-4 (Gal-4) AssayMax ELISA Kit

EG3312-1 96 Well Plate
EUR 477

Gal/ Rat Gal ELISA Kit

ELI-03532r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


BIO-37035 1g Ask for price


HY-101422 100mg
EUR 1083


HY-15934 5g
EUR 215


  • EUR 314.00
  • EUR 189.00
  • 1000 mg
  • 101 mg
  • Shipped within 5-10 working days.


  • EUR 300.00
  • EUR 189.00
  • 1000 mg
  • 100 mg
  • Shipped within 5-10 working days.


abx098142-1ml 1 ml
EUR 398
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


A2539-5000 5 g
EUR 218
Description: Substrate for ? - Galactosidase which produces a rich blue color that can easily be detectedvisually over background.Substrate of choice for blue/white selection of recombinant bacterial colonieswith the lac + genotype.

GAL Antibody

43673-100ul 100ul
EUR 252


EUR 207


EUR 675

GAL antibody

70R-10548 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GAL antibody

GAL Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GAL. Recognizes GAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


M715241 500mg
EUR 202.25
  • Product category: Culture Media/Indicators/Stains


MB1136 250mg
EUR 70.01
  • Product category: Culture Media/Indicators/Stains


BB0083 1g
EUR 90.02
  • Product category: Culture Media/Indicators/Stains


BB1182 250mg
EUR 123.95
  • Product category: Culture Media/Indicators/Stains

Human Galectin-1 (Gal-1) Antibody

30005-05111 150 ug
EUR 261


46-101-RF 1 g/pk
EUR 164
Description: Media Catalog; Classical Media

X-Gal (5-bromo-4-chloro-3-indolyl-beta-galactopyranoside): (1g)

10011-1 1G
EUR 152
Description: Minimum order quantity: 1 unit of 1G

GAL Conjugated Antibody

C43673 100ul
EUR 397

GAL cloning plasmid

CSB-CL009191HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atggcccgaggcagcgccctccttctcgcctccctcctcctcgccgcggccctttctgcctctgcggggctctggtcgccggccaaggaaaaacgaggctggaccctgaacagcgcgggctacctgctgggcccacatgccgttggcaaccacaggtcattcagcgacaagaatgg
  • Show more
Description: A cloning plasmid for the GAL gene.

Galanin (GAL) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody

abx038050-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Galanin (GAL) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Histoclear 1 gal