Ba/F3 P95HER2 Cell Line 

To Order Contact us:

F3 3'UTR GFP Stable Cell Line

TU057163 1.0 ml
EUR 1394

F3 3'UTR Luciferase Stable Cell Line

TU007163 1.0 ml
EUR 1394

RT1-Ba 3'UTR Luciferase Stable Cell Line

TU219772 1.0 ml Ask for price

RT1-Ba 3'UTR GFP Stable Cell Line

TU269772 1.0 ml Ask for price

6-Benzylaminopurine (BA, 6-BA, BAP)

CP055-025 25g
EUR 147

6-Benzylaminopurine (BA, 6-BA, BAP)

CP055-100 100g
EUR 232

Soyasaponin Ba

HY-N0309 10mg
EUR 443

Soyasaponin Ba

N2143-20 20 mg
EUR 282
Description: Extracted from Glycinemax(L.)merr seeds;Store the product in sealed, cool and dry condition

Soyasaponin Ba

TB0715 10mg
EUR 634

RT1-Ba/ Rat RT1-Ba ELISA Kit

ELI-27729r 96 Tests
EUR 886

293AD Cell Line

AD-100 1 vial
EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line

AAV-100 1 vial
EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line

LTV-100 1 vial
EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line

RV-100 1 vial
EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

293/GFP Cell Line

AKR-200 1 vial
EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line

AKR-208 1 vial
EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line

AKR-209 1 vial
EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line

AKR-213 1 vial
EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line

AKR-214 1 vial
EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line

AKR-5104 1 vial
EUR 572

293/Cas9 Cell Line

AKR-5110 1 vial
EUR 572

HeLa/Cas9 Cell Line

AKR-5111 1 vial
EUR 572

F3 Antibody

31131-100ul 100ul
EUR 252

F3 Antibody

31131-50ul 50ul
EUR 187

F3 antibody

38235-100ul 100ul
EUR 252

F3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

F3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against F3. Recognizes F3 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

F3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

F3 Antibody

DF6400 200ul
EUR 304
Description: F3 Antibody detects endogenous levels of total F3.

F3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

F3 antibody

70R-33516 100 ug
EUR 327
Description: Rabbit polyclonal F3 antibody

F3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

F3 Antibody

CSB-PA007928KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

F3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

F3 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F3 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F3 Antibody

ABD6400 100 ug
EUR 438

Ginsenoside F3

HY-N0600 1mg
EUR 205

Ginsenoside F3

N2377-10 10 mg
EUR 514
Description: Extracted from Panax ginseng dried roots;Store the product in sealed, cool and dry condition

Ginsenoside F3

TB0648 10mg
EUR 287

SKOV-3/Luc Cell Line

AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line

AKR-234 1 vial
EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line

AKR-254 1 vial
EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.


AT198 1mg
EUR 1114

6-Benzylaminopurine, 6-BA

  • EUR 175.00
  • EUR 217.00
  • 1 g
  • 5 g
  • Shipped within 5-10 working days.

Human BA ELISA Kit

EHB0641 96Tests
EUR 521


EGTB0641 96Tests
EUR 521

Bovine BA ELISA Kit

EBB0641 96Tests
EUR 521

Canine BA ELISA Kit

ECB0641 96Tests
EUR 521

Anserine BA ELISA Kit

EAB0641 96Tests
EUR 521


AG198 1 mg
EUR 523

Mouse BA ELISA Kit

EMB0641 96Tests
EUR 521


ERB0641 96Tests
EUR 521

Rabbit BA ELISA Kit

ERTB0641 96Tests
EUR 521

Porcine BA ELISA Kit

EPB0641 96Tests
EUR 521

F3 Rabbit pAb

A1378-100ul 100 ul
EUR 308

F3 Rabbit pAb

A1378-200ul 200 ul
EUR 459

F3 Rabbit pAb

A1378-20ul 20 ul
EUR 183

F3 Rabbit pAb

A1378-50ul 50 ul
EUR 223

F3 Blocking Peptide

DF6400-BP 1mg
EUR 195

F3 antibody (Ser290)

70R-33515 100 ug
EUR 327
Description: Rabbit polyclonal F3 antibody (Ser290)

F3 Conjugated Antibody

C31131 100ul
EUR 397

F3 Conjugated Antibody

C38235 100ul
EUR 397

F3 cloning plasmid

CSB-CL007928HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggagacccctgcctggccccgggtcccgcgccccgagaccgccgtcgctcggacgctcctgctcggctgggtcttcgcccaggtggccggcgcttcaggcactacaaatactgtggcagcatataatttaacttggaaatcaactaatttcaagacaattttggagtgggaacc
  • Show more
Description: A cloning plasmid for the F3 gene.

F3 Polyclonal Antibody

A50217 100 µg
EUR 570.55
Description: fast delivery possible

Anti-F3 antibody

STJ23598 100 µl
EUR 277
Description: This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.

Platinum-E Retroviral Packaging Cell Line, Ecotropic

RV-101 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic

RV-102 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic

RV-103 1 vial
EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

EasyComp Fluorescent Particles

EUR 182
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

Custom Phospho peptide Synthesis and Antiibodies Order form

CAP-F3 1 Ask for price

Total Protein - Murine Embryonic Stem Cell Line D3

CBA-305 500 ?g
EUR 345
  • Isolated from mouse ES-D3 cell line
  • Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer

Human Complement Factor Ba Antibody

15662-05011 150 ug
EUR 217

Butyric Acid (BA) ELISA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Guinea Pig BA ELISA Kit

EGB0641 96Tests
EUR 521

3-chloro-5-hydroxy BA

C3411-100 100 mg
EUR 164
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

3-chloro-5-hydroxy BA

C3411-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

3-chloro-5-hydroxy BA

C3411-50 50 mg
EUR 110
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

3-chloro-5-hydroxy BA

C3411-500 500 mg
EUR 550
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

Butyric Acid (BA) CLIA Kit

  • EUR 9242.00
  • EUR 4920.00
  • EUR 1130.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

RT1-Ba Recombinant Protein (Rat)

RP227054 100 ug Ask for price

Human Tissue factor (F3)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tissue factor(F3),partial expressed in E.coli

F3 protein (His tag)

80R-2427 20 ug
EUR 322
Description: Purified recombinant F3 protein (His tag)

Tissue factor (F3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tissue Factor (F3) Antibody

  • EUR 829.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tissue Factor (F3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tissue Factor (F3) Antibody

abx117088-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Tissue Factor (F3) Antibody

abx037991-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Human F3 ELISA Kit

ELA-E0524h 96 Tests
EUR 824

CD142/Tissue factor/F3

E21-479 10ug
EUR 343

F3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

F3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

F3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-F3 (S290) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-F3 (S290). Recognizes Phospho-F3 (S290) from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Tissue factor (F3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tissue factor (F3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tissue factor (F3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tissue Factor (F3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tissue Factor (F3) Protein

  • EUR 328.00
  • EUR 5924.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Mouse F3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human F3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Tissue Factor (F3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

F3 Recombinant Protein (Human)

RP011134 100 ug Ask for price

F3 Recombinant Protein (Rat)

RP200198 100 ug Ask for price

F3 Recombinant Protein (Mouse)

RP132638 100 ug Ask for price

Rat F3 ELISA Kit

STJ150403 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TF in Rat serum, plasma and other biological fluids

Human Blocking antibody,BA ELISA Kit

201-12-1841 96 tests
EUR 440
  • This Blocking antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

General Butyric Acid (BA) ELISA Kit

CEO777Ge-10x96wellstestplate 10x96-wells test plate
EUR 6027.41
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit

CEO777Ge-1x48wellstestplate 1x48-wells test plate
EUR 584.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit

CEO777Ge-1x96wellstestplate 1x96-wells test plate
EUR 791.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit

CEO777Ge-5x96wellstestplate 5x96-wells test plate
EUR 3261.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit

  • EUR 6078.00
  • EUR 3212.00
  • EUR 792.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Butyric Acid elisa. Alternative names of the recognized antigen: Propanecarboxylic Acid
  • Butanoic Acid
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Butyric Acid (BA) in samples from Biological agents with no significant corss-reactivity with analogues from other species.

Human Blocking antibody(BA)ELISA Kit

GA-E1857HM-48T 48T
EUR 289

Human Blocking antibody(BA)ELISA Kit

GA-E1857HM-96T 96T
EUR 466

Anti-Elastin Antibody (monoclonal, BA-4)

MA1038 100ug/vial
EUR 334

RT1-Ba ORF Vector (Rat) (pORF)

ORF075686 1.0 ug DNA
EUR 506

Human Blocking antibody(BA)ELISA Kit

QY-E03546 96T
EUR 374

Goat Blocking antibody,BA ELISA KIT

QY-E140029 96T
EUR 413

General Butyric Acid ELISA Kit (BA)

RK00626 96 Tests
EUR 573


EF000235 96 Tests
EUR 689

Tissue Factor (F3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tissue Factor (F3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tissue Factor (F3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

F3 Polyclonal Antibody, HRP Conjugated

A50218 100 µg
EUR 570.55
Description: reagents widely cited

F3 Polyclonal Antibody, FITC Conjugated

A50219 100 µg
EUR 570.55
Description: Ask the seller for details

F3 Polyclonal Antibody, Biotin Conjugated

A50220 100 µg
EUR 570.55
Description: The best epigenetics products

F3 ORF Vector (Rat) (pORF)

ORF066734 1.0 ug DNA
EUR 506

F3 ORF Vector (Human) (pORF)

ORF003712 1.0 ug DNA
EUR 95

F3 ORF Vector (Mouse) (pORF)

ORF044214 1.0 ug DNA
EUR 506

Anti-Tissue Factor/F3 Antibody

PB9701 100ug/vial
EUR 294

Anti-Tissue Factor/F3 Antibody

PB9702 100ug/vial
EUR 294

F3 ELISA Kit (Human) (OKAN04584)

OKAN04584 96 Wells
EUR 792
Description: Description of target: This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.9 pg/mL

F3 ELISA Kit (Mouse) (OKAN05014)

OKAN05014 96 Wells
EUR 792
Description: Description of target: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

F3 ELISA Kit (Human) (OKBB00852)

OKBB00852 96 Wells
EUR 505
Description: Description of target: Tissue factor, also called platelet tissue factor, factor III, thrombokinase, or CD142 is a protein present in sub endothelial tissue and leukocytes necessary for the initiation of thrombin formation from the zymogene prothrombin. An incorrect synonym is thromboplastin. the F3 gene was mapped to 1pter-p21 by study of somatic cell hybrids with a species-specific sensitive chromogenic assay. This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

F3 ELISA Kit (Rat) (OKCA02255)

OKCA02255 96 Wells
EUR 970
Description: Description of target: Initiates blood coagulation by forming a complex with circulating factor VII or VIIa. The [TF:VIIa] complex activates factors IX or X by specific limited protolysis. TF plays a role in normal hemostasis by initiating the cell-surface assembly and propagation of the coagulation protease cascade. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

F3 ELISA Kit (Human) (OKCD06407)

OKCD06407 96 Wells
EUR 596
Description: Description of target: This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.9pg/mL

F3 ELISA Kit (Mouse) (OKCD06408)

OKCD06408 96 Wells
EUR 779
Description: Description of target: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL

F3 ELISA Kit (Rat) (OKCD06409)

OKCD06409 96 Wells
EUR 818
Description: Description of target: an initiation factor for blood coagulation; plays a critical role in hepatic ischemic reperfusion injury.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 12.4pg/mL

F3 ELISA Kit (Rat) (OKEH04104)

OKEH04104 96 Wells
EUR 596
Description: Description of target: an initiation factor for blood coagulation; plays a critical role in hepatic ischemic reperfusion injury [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.87 pg/mL

Human Complement Factor Ba Antibody (Biotin Conjugate)

15662-05021 150 ug
EUR 276

Cytokeratin 19 (40 kD); Clone BA 17

A00094 6 ml
EUR 220

Cytokeratin 19 (40 kD); Clone BA 17

A00094.0025 25 ml
EUR 514

Cytokeratin 19 (40 kD); Clone BA 17

A20094 2 ml
EUR 136

ELISA kit for General BA (Butyric Acid)

ELK8174 1 plate of 96 wells
EUR 372
  • A monoclonal antibody specific to Butyric Acid (BA) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Butyric Acid (BA) and unlabeled Butyric Acid (BA) (Standards or samples) with the pre-coat
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Butyric Acid from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RT1-Ba sgRNA CRISPR Lentivector set (Rat)

K7531001 3 x 1.0 ug
EUR 339

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric

CBA-135 96 assays
EUR 821
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric

CBA-135-5 5 x 96 assays
EUR 3356
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric

CBA-140 96 assays
EUR 856
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric

CBA-140-5 5 x 96 assays
EUR 3483
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)

CBA-325 96 assays
EUR 856
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)

CBA-325-5 5 x 96 assays
EUR 3361
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

Rat F3/ Tissue factor ELISA Kit

E0341Ra 1 Kit
EUR 563

Mouse F3/ Tissue factor ELISA Kit

E0485Mo 1 Kit
EUR 571

Human F3/ Tissue factor ELISA Kit

E0839Hu 1 Kit
EUR 537

F3 sgRNA CRISPR Lentivector set (Human)

K0706601 3 x 1.0 ug
EUR 339

F3 sgRNA CRISPR Lentivector set (Rat)

K6868601 3 x 1.0 ug
EUR 339

F3 sgRNA CRISPR Lentivector set (Mouse)

K4421901 3 x 1.0 ug
EUR 339

Human Tissue factor/F3 ELISA Kit

LF-EK50954 1×96T
EUR 648

Anti-Creatine Kinase MM (3E1-F3)

YF-MA12457 50 ug
EUR 363
Description: Mouse monoclonal to Creatine Kinase MM

Anti-Creatine Kinase MM (3E1-F3)

YF-MA12458 200 ul
EUR 363
Description: Mouse monoclonal to Creatine Kinase MM

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric, Trial Size

CBA-135-T 24 assays
EUR 432
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric), Trial Size

CBA-140-T 24 assays
EUR 456
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

Collagen-based Cell Contraction Assay

CBA-201 24 assays
EUR 485
Description: Cell Biolabs? Collagen-based Contraction Assay Kit provides a simple system to assess cell contractivity in vitro and screen cell contraction mediators. Each kit provides sufficient quantities to perform up to 24 assays in a 24-well plate. The kit can be also used in culturing cells in 3D collagen matrix.

CytoSelect MTT Cell Proliferation Assay

CBA-252 960 assays
EUR 409
Description: Cell Biolabs? CytoSelect MTT Cell Proliferation Assay provides a colorimetric format for measuring and monitoring cell proliferation.  The kit contains sufficient reagents for the evaluation of 960 assays in 96-well plates or 192 assays in 24-well plates.  Cells can be plated and then treated with compounds or agents that affect proliferation.  Cells are then detected with the proliferation reagent, which is converted in live cells from the yellow tetrazole MTT to the purple formazan form by a cellular reductase (Figure 1).  An increase in cell proliferation is accompanied by an increased signal, while a decrease in cell proliferation (and signal) can indicate the toxic effects of compounds or suboptimal culture conditions.  The assay principles are basic and can be applied to most eukaryotic cell lines, including adherent and non-adherent cells and certain tissues.  This cell proliferation reagent can be used to detect proliferation in bacteria, yeast, fungi, protozoa as well as cultured mammalian and piscine cells.

Human Complement Factor Ba AssayLite Antibody (FITC Conjugate)

15662-05041 150 ug
EUR 428

Human Complement Factor Ba AssayLite Antibody (RPE Conjugate)

15662-05051 150 ug
EUR 428

Human Complement Factor Ba AssayLite Antibody (APC Conjugate)

15662-05061 150 ug
EUR 428

Human Complement Factor Ba AssayLite Antibody (PerCP Conjugate)

15662-05071 150 ug
EUR 471

RT1-Ba sgRNA CRISPR Lentivector (Rat) (Target 1)

K7531002 1.0 ug DNA
EUR 154

RT1-Ba sgRNA CRISPR Lentivector (Rat) (Target 2)

K7531003 1.0 ug DNA
EUR 154

RT1-Ba sgRNA CRISPR Lentivector (Rat) (Target 3)

K7531004 1.0 ug DNA
EUR 154

RT1-Ba Protein Vector (Rat) (pPB-C-His)

PV302742 500 ng
EUR 603

RT1-Ba Protein Vector (Rat) (pPB-N-His)

PV302743 500 ng
EUR 603

RT1-Ba Protein Vector (Rat) (pPM-C-HA)

PV302744 500 ng
EUR 603

RT1-Ba Protein Vector (Rat) (pPM-C-His)

PV302745 500 ng
EUR 603

CytoSelect 24-well Cell Invasion, Fluorometric

CBA-111 12 assays
EUR 595
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

CytoSelect 96-well Cell Invasion, Fluorometric

CBA-112 96 assays
EUR 757
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect 96-Well Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 96-well plates on a fluorescence plate reader. Inserts are precoated on the top of the membrane with Basement Membrane, an ECM protein mix isolated from EHS tumor cells.

Radius 24-Well Cell Migration Assay

CBA-125 24 assays
EUR 502
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 24-Well Cell Migration Assay

CBA-125-5 5 x 24 assays
EUR 1969
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 96-Well Cell Migration Assay

CBA-126 96 assays
EUR 572
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 96-Well Cell Migration Assay

CBA-126-5 5 x 96 assays
EUR 2248
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 384-Well Cell Migration Assay

CBA-127 384 assays
EUR 601
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 384-Well Cell Migration Assay

CBA-127-5 5 x 384 wells
EUR 2335
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

CytoSelect 96-well Cell Transformation Assay

CBA-130 96 assays
EUR 722
Description: Our CytoSelect 96-Well Cell Transformation Assay (Soft Agar Colony Formation) is suitable for measuring cell transformation where no downstream analysis is required. Cells are incubated in a semisolid agar medium for 7-8 days. The cells are then solubilized, lysed and detected using the included fluorescent dye in a fluorometric plate reader.

CytoSelect 96-well Cell Transformation Assay

CBA-130-5 5 x 96 assays
EUR 2886
Description: Our CytoSelect 96-Well Cell Transformation Assay (Soft Agar Colony Formation) is suitable for measuring cell transformation where no downstream analysis is required. Cells are incubated in a semisolid agar medium for 7-8 days. The cells are then solubilized, lysed and detected using the included fluorescent dye in a fluorometric plate reader.

CytoSelect Cell Viability and Cytotoxicity Assay

CBA-240 96 assays
EUR 392
Description: The CytoSelect Cell Viability and Cytotoxicity Assay Kit provides a simple format for monitoring cell viability via metabolic activity. Live cells are detected with either MTT (colorimetric detection) or Calcein AM (fluorometric detection). Dead cells are detected by EthD-1 reagent (fluorometric). All 3 detection reagents are included, along with Saponin (a cell death initiator). Prior to the assay, cells may be treated with compounds or agents that affect cell viability. This kit is suitable for eukaryotic cells, not yeast or bacteria.

CytoSelect Cell Proliferation Assay Reagent (Fluorometric)

CBA-250 10 mL
EUR 409
Description: Cell Biolabs? CytoSelect Cell Proliferation Assay Reagent (Fluorometric) provides a fluorometric format for measuring and monitoring cell proliferation. Cells can be plated and then treated with compounds or agents that affect proliferation.  Cells are then incubated with the proliferation reagent.  Upon entering metabolically active live cells, the non-fluorescent proliferation reagent is converted into a bright red fluorescent form. An increase in cell proliferation is accompanied by increased fluorescent signal, while a decrease in cell proliferation (and signal) can indicate the toxic effects of compounds or suboptimal culture conditions.  The assay principles are basic and can be applied to most eukaryotic cell lines, including adherent and non-adherent cells and certain tissues.  This cell proliferation reagent can be used to detect proliferation in bacteria, yeast, fungi, protozoa as well as cultured mammalian and piscine cells. The kit contains sufficient reagents for the evaluation of 960 assays in ten 96-well plates or 192 assays in eight 24-well plates.

CytoSelect BrdU Cell Proliferation ELISA Kit

CBA-251 96 assays
EUR 531
Description: The CytoSelect BrdU Cell Proliferation ELISA Kit detects BrdU incorporated into cellular DNA during cell proliferation using an anti-BrdU antibody.  When cells are incubated in media containing BrdU, the pyrimidine analog is incorporated in place of thymidine into the newly synthesized DNA of proliferating cells.  Once the labeling media is removed, the cells are fixed and the DNA is denatured in one step with a fix/denature solution (denaturation of the DNA is necessary to improve the accessibility of the incorporated BrdU for detection).  Then an anti-BrdU mouse monoclonal antibody is added followed by an HRP conjugated secondary antibody to detect the incorporated BrdU.  The magnitude of the absorbance for the developed color is proportional to the quantity of BrdU incorporated into cells and can be directly correlated to cell proliferation.

CytoSelect Cell Proliferation Assay Reagent (Colorimetric)

CBA-253 10 mL
EUR 409
Description: Cell Biolabs? CytoSelect WST-1 Cell Proliferation Assay Reagent provides a colorimetric format for measuring and monitoring cell proliferation.  The 10 mL volume is sufficient for the evaluation of 960 assays in ten 96-well plates or 192 assays in eight 24-well plates.  Cells can be plated and then treated with compounds or agents that affect proliferation.  Cells are then detected with the proliferation reagent, which is converted in live cells from WST-1 to the formazan form in the presence of cellular NADH and an electron mediator. An increase in cell proliferation is accompanied by increased signal, while a decrease in cell proliferation (and signal) can indicate the toxic effects of compounds or suboptimal culture conditions.  The assay principles are basic and can be applied to most eukaryotic cell lines, including adherent and non-adherent cells and certain tissues.  This cell proliferation reagent can be used to detect proliferation in bacteria, yeast, fungi, protozoa as well as cultured mammalian and piscine cells.

Radius 48-Well Cell Migration Assay

CBA-5037 48 assays
EUR 519
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 48-Well Cell Migration Assay

CBA-5037-5 5 x 48 assays
EUR 2045
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

ELISA kit for Mouse Tissue Factor/F3

EK5631 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Tissue Factor/F3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Tissue factor/F3 PicoKine ELISA Kit

EK0928 96 wells
EUR 425
Description: For quantitative detection of human Tissue factor in cell culture supernates, serum, plasma(heparin, EDTA, citrate), Cell lysates, and urine.

Ba/F3 P95HER2 Cell Line