Ba/F3 P95HER2 Cell Line 

To Order Contact us: stephen@expresspharmapulse.com

F3 3'UTR GFP Stable Cell Line
TU057163	ABM	1.0 ml	EUR 1394

F3 3'UTR GFP Stable Cell Line
TU254191	ABM	1.0 ml	Ask for price

RT1-Ba 3'UTR Luciferase Stable Cell Line
TU219772	ABM	1.0 ml	Ask for price

RT1-Ba 3'UTR GFP Stable Cell Line
TU269772	ABM	1.0 ml	Ask for price

6-Benzylaminopurine (BA, 6-BA, BAP)
CP055-025	GenDepot	25g	EUR 147

6-Benzylaminopurine (BA, 6-BA, BAP)
CP055-100	GenDepot	100g	EUR 232

Soyasaponin Ba
HY-N0309	MedChemExpress	10mg	EUR 443

Soyasaponin Ba
N2143-20	ApexBio	20 mg	EUR 282
Description: Extracted from Glycinemax(L.)merr seeds;Store the product in sealed, cool and dry condition

Soyasaponin Ba
TB0715	ChemNorm	10mg	EUR 634

RT1-Ba/ Rat RT1-Ba ELISA Kit
ELI-27729r	Lifescience Market	96 Tests	EUR 886

293AD Cell Line
AD-100	Cell Biolabs	1 vial	EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line
AAV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line
LTV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line
RV-100	Cell Biolabs	1 vial	EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

293/GFP Cell Line
AKR-200	Cell Biolabs	1 vial	EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line
AKR-208	Cell Biolabs	1 vial	EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line
AKR-209	Cell Biolabs	1 vial	EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line
AKR-213	Cell Biolabs	1 vial	EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line
AKR-214	Cell Biolabs	1 vial	EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line
AKR-5104	Cell Biolabs	1 vial	EUR 572

293/Cas9 Cell Line
AKR-5110	Cell Biolabs	1 vial	EUR 572

HeLa/Cas9 Cell Line
AKR-5111	Cell Biolabs	1 vial	EUR 572

Ginsenoside F3
HY-N0600	MedChemExpress	1mg	EUR 205

F3 siRNA
20-abx915883	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

F3 siRNA
20-abx915884	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

F3 antibody
70R-33516	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal F3 antibody

F3 Antibody
ABD6400	Lifescience Market	100 ug	EUR 438

F3 antibody
38235-100ul	SAB	100ul	EUR 252

F3 Antibody
31131-100ul	SAB	100ul	EUR 252

F3 Antibody
31131-50ul	SAB	50ul	EUR 187

F3 Antibody
DF6400	Affbiotech	200ul	EUR 304
Description: F3 Antibody detects endogenous levels of total F3.

F3 Antibody
1-CSB-PA981490	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

F3 Antibody
1-CSB-PA005114	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

F3 Antibody
CSB-PA007928KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

F3 Antibody
CSB-PA007928KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

F3 Antibody
1-CSB-PA007928LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

F3 Antibody
1-CSB-PA004263	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against F3. Recognizes F3 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

F3 Antibody
1-CSB-PA040718	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

Ginsenoside F3
N2377-10	ApexBio	10 mg	EUR 514
Description: Extracted from Panax ginseng dried roots;Store the product in sealed, cool and dry condition

Ginsenoside F3
TB0648	ChemNorm	10mg	EUR 287

SKOV-3/Luc Cell Line
AKR-232	Cell Biolabs	1 vial	EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line
AKR-234	Cell Biolabs	1 vial	EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line
AKR-254	Cell Biolabs	1 vial	EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

6-Benzylaminopurine（6-BA)
AG198	Unibiotest	1 mg	EUR 523

6-Benzylaminopurine（6-BA)
AT198	Unibiotest	1mg	EUR 1114

Human BA ELISA Kit
EHB0641	Abclonal	96Tests	EUR 521

Goat BA ELISA Kit
EGTB0641	Abclonal	96Tests	EUR 521

Canine BA ELISA Kit
ECB0641	Abclonal	96Tests	EUR 521

Bovine BA ELISA Kit
EBB0641	Abclonal	96Tests	EUR 521

Anserine BA ELISA Kit
EAB0641	Abclonal	96Tests	EUR 521

Rat BA ELISA Kit
ERB0641	Abclonal	96Tests	EUR 521

Rabbit BA ELISA Kit
ERTB0641	Abclonal	96Tests	EUR 521

Porcine BA ELISA Kit
EPB0641	Abclonal	96Tests	EUR 521

Mouse BA ELISA Kit
EMB0641	Abclonal	96Tests	EUR 521

6-Benzylaminopurine, 6-BA
20-abx082080	Abbexa	EUR 175.00 EUR 217.00	1 g 5 g
Shipped within 5-10 working days.

F3 Conjugated Antibody
C38235	SAB	100ul	EUR 397

F3 Conjugated Antibody
C31131	SAB	100ul	EUR 397

F3 cloning plasmid
CSB-CL007928HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 888 Sequence: atggagacccctgcctggccccgggtcccgcgccccgagaccgccgtcgctcggacgctcctgctcggctgggtcttcgcccaggtggccggcgcttcaggcactacaaatactgtggcagcatataatttaacttggaaatcaactaatttcaagacaattttggagtgggaacc Show more
Description: A cloning plasmid for the F3 gene.

F3 Polyclonal Antibody
A50217	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

F3 antibody (Ser290)
70R-33515	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal F3 antibody (Ser290)

F3 Rabbit pAb
A1378-100ul	Abclonal	100 ul	EUR 308

F3 Rabbit pAb
A1378-200ul	Abclonal	200 ul	EUR 459

F3 Rabbit pAb
A1378-20ul	Abclonal	20 ul	EUR 183

F3 Rabbit pAb
A1378-50ul	Abclonal	50 ul	EUR 223

F3 Blocking Peptide
DF6400-BP	Affbiotech	1mg	EUR 195

Anti-F3 antibody
STJ23598	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.

Platinum-E Retroviral Packaging Cell Line, Ecotropic
RV-101	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-E cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-A Retroviral Packaging Cell Line, Amphotropic
RV-102	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-A cells contain gag, pol and env genes, allowing retroviral packaging with a single plasmid transfection.

Platinum-GP Retroviral Packaging Cell Line, Pantropic
RV-103	Cell Biolabs	1 vial	EUR 920
Description: Conventional cells used for retrovirus packaging, such as those based on NIH3T3 cells, have limited stability and produce relatively low yields of retrovirus, mainly due to the poor expression of retroviral structure proteins (gag, pol and env) in the cells. The Platinum Retroviral Packaging Cell Lines are based on the 293T cell line. They exhibit longer stability and produce higher yields of retroviral structure proteins. Plat-GP cells contain the gag and pol genes required for retroviral packaging; an expression vector is co-transfected with a VSVG envelope vector.

Custom Phospho peptide Synthesis and Antiibodies Order form
CAP-F3	Alpha Diagnostics	1	Ask for price

EasyComp Fluorescent Particles
ECFP-F3	Spherotech	mL	EUR 182
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

Total Protein - Murine Embryonic Stem Cell Line D3
CBA-305	Cell Biolabs	500 ?g	EUR 345
Description: Isolated from mouse ES-D3 cell line Presented as 500 µg at 1 mg/mL in NP-40 Solubilization Buffer

3-chloro-5-hydroxy BA
C3411-100	ApexBio	100 mg	EUR 164
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

3-chloro-5-hydroxy BA
C3411-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 113
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

3-chloro-5-hydroxy BA
C3411-50	ApexBio	50 mg	EUR 110
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

3-chloro-5-hydroxy BA
C3411-500	ApexBio	500 mg	EUR 550
Description: 3-chloro-5-hydroxy BA is a GPR81 agonist. GPR81 (HCA1) is a member of G-protein-coupled receptors (GPCRs).

Guinea Pig BA ELISA Kit
EGB0641	Abclonal	96Tests	EUR 521

Butyric Acid (BA) CLIA Kit
20-abx490545	Abbexa	EUR 9242.00 EUR 4920.00 EUR 1130.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Butyric Acid (BA) ELISA Kit
20-abx258338	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Complement Factor Ba Antibody
15662-05011	AssayPro	150 ug	EUR 217

RT1-Ba Recombinant Protein (Rat)
RP227054	ABM	100 ug	Ask for price

Human F3 ELISA Kit
ELA-E0524h	Lifescience Market	96 Tests	EUR 824

CD142/Tissue factor/F3
E21-479	EnoGene	10ug	EUR 343

Tissue Factor (F3) Antibody
abx117088-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Tissue Factor (F3) Antibody
20-abx001211	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tissue Factor (F3) Antibody
abx037991-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tissue Factor (F3) Antibody
20-abx100873	Abbexa	EUR 829.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tissue Factor (F3) Antibody
20-abx100876	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tissue factor (F3) Antibody
20-abx323788	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tissue factor (F3) Antibody
20-abx325045	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tissue factor (F3) Antibody
20-abx339467	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tissue Factor (F3) Antibody
20-abx303791	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tissue Factor (F3) Protein
20-abx262300	Abbexa	EUR 328.00 EUR 5924.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Tissue factor (F3) Antibody
20-abx210516	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human F3 shRNA Plasmid
20-abx951496	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

F3 protein (His tag)
80R-2427	Fitzgerald	20 ug	EUR 322
Description: Purified recombinant F3 protein (His tag)

Mouse F3 shRNA Plasmid
20-abx970264	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Tissue factor (F3)
1-CSB-EP007928HU1	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 40.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tissue factor(F3),partial expressed in E.coli

F3 Antibody, HRP conjugated
1-CSB-PA007928LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

F3 Antibody, FITC conjugated
1-CSB-PA007928LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

F3 Antibody, Biotin conjugated
1-CSB-PA007928LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F3. Recognizes F3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-F3 (S290) Antibody
1-CSB-PA008166	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-F3 (S290). Recognizes Phospho-F3 (S290) from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

F3 Recombinant Protein (Human)
RP011134	ABM	100 ug	Ask for price

F3 Recombinant Protein (Rat)
RP200198	ABM	100 ug	Ask for price

F3 Recombinant Protein (Mouse)
RP132638	ABM	100 ug	Ask for price

Rat F3 ELISA Kit
STJ150403	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of TF in Rat serum, plasma and other biological fluids

Human Blocking antibody(BA)ELISA Kit
GA-E1857HM-48T	GenAsia Biotech	48T	EUR 289

Human Blocking antibody(BA)ELISA Kit
GA-E1857HM-96T	GenAsia Biotech	96T	EUR 466

Human Blocking antibody,BA ELISA Kit
201-12-1841	SunredBio	96 tests	EUR 440
This Blocking antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

General Butyric Acid (BA) ELISA Kit
CEO777Ge-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 6027.41
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit
CEO777Ge-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 584.02
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit
CEO777Ge-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 791.46
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit
CEO777Ge-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3261.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Butyric Acid (BA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Butyric Acid (BA) in Biological agents.

General Butyric Acid (BA) ELISA Kit
4-CEO777Ge	Cloud-Clone	EUR 6078.00 EUR 3212.00 EUR 792.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Butyric Acid elisa. Alternative names of the recognized antigen: Propanecarboxylic Acid Butanoic Acid
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Butyric Acid (BA) in samples from Biological agents with no significant corss-reactivity with analogues from other species.

Anti-Elastin Antibody (monoclonal, BA-4)
MA1038	BosterBio	100ug/vial	EUR 334

RT1-Ba ORF Vector (Rat) (pORF)
ORF075686	ABM	1.0 ug DNA	EUR 506

General Butyric Acid ELISA Kit (BA)
RK00626	Abclonal	96 Tests	EUR 573

Human Blocking antibody(BA)ELISA Kit
QY-E03546	Qayee Biotechnology	96T	EUR 374

Goat Blocking antibody,BA ELISA KIT
QY-E140029	Qayee Biotechnology	96T	EUR 413

TF/F3 ELISA KIT|Human
EF000235	Lifescience Market	96 Tests	EUR 689

Tissue Factor (F3) Antibody (HRP)
20-abx303792	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tissue Factor (F3) Antibody (FITC)
20-abx303793	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tissue Factor (F3) Antibody (Biotin)
20-abx303794	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

F3 Polyclonal Antibody, HRP Conjugated
A50218	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

F3 Polyclonal Antibody, FITC Conjugated
A50219	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

F3 Polyclonal Antibody, Biotin Conjugated
A50220	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

F3 ORF Vector (Human) (pORF)
ORF003712	ABM	1.0 ug DNA	EUR 95

Anti-Tissue Factor/F3 Antibody
PB9701	BosterBio	100ug/vial	EUR 294

Anti-Tissue Factor/F3 Antibody
PB9702	BosterBio	100ug/vial	EUR 294

F3 ORF Vector (Rat) (pORF)
ORF066734	ABM	1.0 ug DNA	EUR 506

F3 ORF Vector (Mouse) (pORF)
ORF044214	ABM	1.0 ug DNA	EUR 506

F3 ELISA Kit (Human) (OKAN04584)
OKAN04584	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.9 pg/mL

F3 ELISA Kit (Mouse) (OKAN05014)
OKAN05014	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

F3 ELISA Kit (Human) (OKCD06407)
OKCD06407	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. There are 3 distinct domains of this factor: extracellular, transmembrane, and cytoplasmic. This protein is the only one in the coagulation pathway for which a congenital deficiency has not been described. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.9pg/mL

F3 ELISA Kit (Mouse) (OKCD06408)
OKCD06408	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL

F3 ELISA Kit (Rat) (OKCD06409)
OKCD06409	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: an initiation factor for blood coagulation; plays a critical role in hepatic ischemic reperfusion injury.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 12.4pg/mL

F3 ELISA Kit (Human) (OKBB00852)
OKBB00852	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Tissue factor, also called platelet tissue factor, factor III, thrombokinase, or CD142 is a protein present in sub endothelial tissue and leukocytes necessary for the initiation of thrombin formation from the zymogene prothrombin. An incorrect synonym is thromboplastin. the F3 gene was mapped to 1pter-p21 by study of somatic cell hybrids with a species-specific sensitive chromogenic assay. This gene encodes coagulation factor III which is a cell surface glycoprotein. This factor enables cells to initiate the blood coagulation cascades, and it functions as the high-affinity receptor for the coagulation factor VII.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

F3 ELISA Kit (Rat) (OKCA02255)
OKCA02255	Aviva Systems Biology	96 Wells	EUR 970
Description: Description of target: Initiates blood coagulation by forming a complex with circulating factor VII or VIIa. The [TF:VIIa] complex activates factors IX or X by specific limited protolysis. TF plays a role in normal hemostasis by initiating the cell-surface assembly and propagation of the coagulation protease cascade. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

F3 ELISA Kit (Rat) (OKEH04104)
OKEH04104	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: an initiation factor for blood coagulation; plays a critical role in hepatic ischemic reperfusion injury [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.87 pg/mL

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric
CBA-135	Cell Biolabs	96 assays	EUR 821
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric
CBA-135-5	Cell Biolabs	5 x 96 assays	EUR 3356
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric
CBA-140	Cell Biolabs	96 assays	EUR 856
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric
CBA-140-5	Cell Biolabs	5 x 96 assays	EUR 3483
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

ELISA kit for General BA (Butyric Acid)
ELK8174	ELK Biotech	1 plate of 96 wells	EUR 372
A monoclonal antibody specific to Butyric Acid (BA) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Butyric Acid (BA) and unlabeled Butyric Acid (BA) (Standards or samples) with the pre-coat Show more
Description: A competitive Inhibition ELISA kit for detection of Butyric Acid from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Cytokeratin 19 (40 kD); Clone BA 17
A00094	ScyTek Laboratories	6 ml	EUR 220

Cytokeratin 19 (40 kD); Clone BA 17
A00094.0025	ScyTek Laboratories	25 ml	EUR 514

Cytokeratin 19 (40 kD); Clone BA 17
A20094	ScyTek Laboratories	2 ml	EUR 136

Human Complement Factor Ba Antibody (Biotin Conjugate)
15662-05021	AssayPro	150 ug	EUR 276

RT1-Ba sgRNA CRISPR Lentivector set (Rat)
K7531001	ABM	3 x 1.0 ug	EUR 339

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)
CBA-325	Cell Biolabs	96 assays	EUR 856
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)
CBA-325-5	Cell Biolabs	5 x 96 assays	EUR 3361
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

Mouse F3/ Tissue factor ELISA Kit
E0485Mo	Sunlong	1 Kit	EUR 571

Rat F3/ Tissue factor ELISA Kit
E0341Ra	Sunlong	1 Kit	EUR 563

Human F3/ Tissue factor ELISA Kit
E0839Hu	Sunlong	1 Kit	EUR 537

F3 sgRNA CRISPR Lentivector set (Mouse)
K4421901	ABM	3 x 1.0 ug	EUR 339

F3 sgRNA CRISPR Lentivector set (Human)
K0706601	ABM	3 x 1.0 ug	EUR 339

F3 sgRNA CRISPR Lentivector set (Rat)
K6868601	ABM	3 x 1.0 ug	EUR 339

Human Tissue factor/F3 ELISA Kit
LF-EK50954	Abfrontier	1×96T	EUR 648

Anti-Creatine Kinase MM (3E1-F3)
YF-MA12457	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to Creatine Kinase MM

Anti-Creatine Kinase MM (3E1-F3)
YF-MA12458	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to Creatine Kinase MM

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric, Trial Size
CBA-135-T	Cell Biolabs	24 assays	EUR 432
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric), Trial Size
CBA-140-T	Cell Biolabs	24 assays	EUR 456
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

Collagen-based Cell Contraction Assay
CBA-201	Cell Biolabs	24 assays	EUR 485
Description: Cell Biolabs? Collagen-based Contraction Assay Kit provides a simple system to assess cell contractivity in vitro and screen cell contraction mediators. Each kit provides sufficient quantities to perform up to 24 assays in a 24-well plate. The kit can be also used in culturing cells in 3D collagen matrix.

CytoSelect MTT Cell Proliferation Assay
CBA-252	Cell Biolabs	960 assays	EUR 409
Description: Cell Biolabs? CytoSelect MTT Cell Proliferation Assay provides a colorimetric format for measuring and monitoring cell proliferation.  The kit contains sufficient reagents for the evaluation of 960 assays in 96-well plates or 192 assays in 24-well plates.  Cells can be plated and then treated with compounds or agents that affect proliferation.  Cells are then detected with the proliferation reagent, which is converted in live cells from the yellow tetrazole MTT to the purple formazan form by a cellular reductase (Figure 1).  An increase in cell proliferation is accompanied by an increased signal, while a decrease in cell proliferation (and signal) can indicate the toxic effects of compounds or suboptimal culture conditions.  The assay principles are basic and can be applied to most eukaryotic cell lines, including adherent and non-adherent cells and certain tissues.  This cell proliferation reagent can be used to detect proliferation in bacteria, yeast, fungi, protozoa as well as cultured mammalian and piscine cells.

Human Complement Factor Ba AssayLite Antibody (FITC Conjugate)
15662-05041	AssayPro	150 ug	EUR 428

Human Complement Factor Ba AssayLite Antibody (RPE Conjugate)
15662-05051	AssayPro	150 ug	EUR 428

Human Complement Factor Ba AssayLite Antibody (APC Conjugate)
15662-05061	AssayPro	150 ug	EUR 428

Human Complement Factor Ba AssayLite Antibody (PerCP Conjugate)
15662-05071	AssayPro	150 ug	EUR 471

RT1-Ba sgRNA CRISPR Lentivector (Rat) (Target 1)
K7531002	ABM	1.0 ug DNA	EUR 154

RT1-Ba sgRNA CRISPR Lentivector (Rat) (Target 2)
K7531003	ABM	1.0 ug DNA	EUR 154

RT1-Ba sgRNA CRISPR Lentivector (Rat) (Target 3)
K7531004	ABM	1.0 ug DNA	EUR 154

RT1-Ba Protein Vector (Rat) (pPB-C-His)
PV302742	ABM	500 ng	EUR 603

RT1-Ba Protein Vector (Rat) (pPB-N-His)
PV302743	ABM	500 ng	EUR 603

RT1-Ba Protein Vector (Rat) (pPM-C-HA)
PV302744	ABM	500 ng	EUR 603

RT1-Ba Protein Vector (Rat) (pPM-C-His)
PV302745	ABM	500 ng	EUR 603

CytoSelect 24-well Cell Invasion, Fluorometric
CBA-111	Cell Biolabs	12 assays	EUR 595
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

CytoSelect 96-well Cell Invasion, Fluorometric
CBA-112	Cell Biolabs	96 assays	EUR 757
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect 96-Well Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 96-well plates on a fluorescence plate reader. Inserts are precoated on the top of the membrane with Basement Membrane, an ECM protein mix isolated from EHS tumor cells.

Radius 24-Well Cell Migration Assay
CBA-125	Cell Biolabs	24 assays	EUR 502
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 24-Well Cell Migration Assay
CBA-125-5	Cell Biolabs	5 x 24 assays	EUR 1969
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 96-Well Cell Migration Assay
CBA-126	Cell Biolabs	96 assays	EUR 572
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 96-Well Cell Migration Assay
CBA-126-5	Cell Biolabs	5 x 96 assays	EUR 2248
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 384-Well Cell Migration Assay
CBA-127	Cell Biolabs	384 assays	EUR 601
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 384-Well Cell Migration Assay
CBA-127-5	Cell Biolabs	5 x 384 wells	EUR 2335
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

CytoSelect 96-well Cell Transformation Assay
CBA-130	Cell Biolabs	96 assays	EUR 722
Description: Our CytoSelect 96-Well Cell Transformation Assay (Soft Agar Colony Formation) is suitable for measuring cell transformation where no downstream analysis is required. Cells are incubated in a semisolid agar medium for 7-8 days. The cells are then solubilized, lysed and detected using the included fluorescent dye in a fluorometric plate reader.

CytoSelect 96-well Cell Transformation Assay
CBA-130-5	Cell Biolabs	5 x 96 assays	EUR 2886
Description: Our CytoSelect 96-Well Cell Transformation Assay (Soft Agar Colony Formation) is suitable for measuring cell transformation where no downstream analysis is required. Cells are incubated in a semisolid agar medium for 7-8 days. The cells are then solubilized, lysed and detected using the included fluorescent dye in a fluorometric plate reader.

CytoSelect Cell Viability and Cytotoxicity Assay
CBA-240	Cell Biolabs	96 assays	EUR 392
Description: The CytoSelect Cell Viability and Cytotoxicity Assay Kit provides a simple format for monitoring cell viability via metabolic activity. Live cells are detected with either MTT (colorimetric detection) or Calcein AM (fluorometric detection). Dead cells are detected by EthD-1 reagent (fluorometric). All 3 detection reagents are included, along with Saponin (a cell death initiator). Prior to the assay, cells may be treated with compounds or agents that affect cell viability. This kit is suitable for eukaryotic cells, not yeast or bacteria.

CytoSelect Cell Proliferation Assay Reagent (Fluorometric)
CBA-250	Cell Biolabs	10 mL	EUR 409
Description: Cell Biolabs? CytoSelect Cell Proliferation Assay Reagent (Fluorometric) provides a fluorometric format for measuring and monitoring cell proliferation. Cells can be plated and then treated with compounds or agents that affect proliferation.  Cells are then incubated with the proliferation reagent.  Upon entering metabolically active live cells, the non-fluorescent proliferation reagent is converted into a bright red fluorescent form. An increase in cell proliferation is accompanied by increased fluorescent signal, while a decrease in cell proliferation (and signal) can indicate the toxic effects of compounds or suboptimal culture conditions.  The assay principles are basic and can be applied to most eukaryotic cell lines, including adherent and non-adherent cells and certain tissues.  This cell proliferation reagent can be used to detect proliferation in bacteria, yeast, fungi, protozoa as well as cultured mammalian and piscine cells. The kit contains sufficient reagents for the evaluation of 960 assays in ten 96-well plates or 192 assays in eight 24-well plates.

CytoSelect BrdU Cell Proliferation ELISA Kit
CBA-251	Cell Biolabs	96 assays	EUR 531
Description: The CytoSelect BrdU Cell Proliferation ELISA Kit detects BrdU incorporated into cellular DNA during cell proliferation using an anti-BrdU antibody.  When cells are incubated in media containing BrdU, the pyrimidine analog is incorporated in place of thymidine into the newly synthesized DNA of proliferating cells.  Once the labeling media is removed, the cells are fixed and the DNA is denatured in one step with a fix/denature solution (denaturation of the DNA is necessary to improve the accessibility of the incorporated BrdU for detection).  Then an anti-BrdU mouse monoclonal antibody is added followed by an HRP conjugated secondary antibody to detect the incorporated BrdU.  The magnitude of the absorbance for the developed color is proportional to the quantity of BrdU incorporated into cells and can be directly correlated to cell proliferation.

CytoSelect Cell Proliferation Assay Reagent (Colorimetric)
CBA-253	Cell Biolabs	10 mL	EUR 409
Description: Cell Biolabs? CytoSelect WST-1 Cell Proliferation Assay Reagent provides a colorimetric format for measuring and monitoring cell proliferation.  The 10 mL volume is sufficient for the evaluation of 960 assays in ten 96-well plates or 192 assays in eight 24-well plates.  Cells can be plated and then treated with compounds or agents that affect proliferation.  Cells are then detected with the proliferation reagent, which is converted in live cells from WST-1 to the formazan form in the presence of cellular NADH and an electron mediator. An increase in cell proliferation is accompanied by increased signal, while a decrease in cell proliferation (and signal) can indicate the toxic effects of compounds or suboptimal culture conditions.  The assay principles are basic and can be applied to most eukaryotic cell lines, including adherent and non-adherent cells and certain tissues.  This cell proliferation reagent can be used to detect proliferation in bacteria, yeast, fungi, protozoa as well as cultured mammalian and piscine cells.

Radius 48-Well Cell Migration Assay
CBA-5037	Cell Biolabs	48 assays	EUR 519
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Radius 48-Well Cell Migration Assay
CBA-5037-5	Cell Biolabs	5 x 48 assays	EUR 2045
Description: The Radius Cell Migration Assay provides a unique alternative to conventional cell migration assays using the Boyden chamber. Unlike Boyden chamber assays which may only be analyzed at endpoint, the Radius assay uses a proprietary cell culture plate containing a carefully-defined biocompatible hydrogel (Radius gel) spot centralized at the bottom of each well. When cells are seeded in the well, they will attach everywhere except on the Radius gel, creating a cell-free zone. Following cell seeding the Radius gel is removed, allowing migratory cells to move across the area and close the gap.

Monoclonal F3 Antibody (monoclonal) (M01), Clone: 4G4
AMM03509G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human F3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4G4. This antibody is applicable in WB, IP, E

Anti-F3 (clone b12)-Mc-MMAF ADC
ADC-W-439	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-F3 monoclonal antibody (clone b12) conjugated via a Mc linker to MMAF

Ba/F3 P95HER2 Cell Line