Human SLN(Sarcolipin) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Sarcolipin (SLN) ELISA Kit
RDR-SLN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sarcolipin (SLN) ELISA Kit
RDR-SLN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Sarcolipin (SLN) ELISA Kit
DLR-SLN-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit
DLR-SLN-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Sarcolipin (SLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Sarcolipin (SLN) in samples from tissue homogenates or other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit
RD-SLN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Sarcolipin (SLN) ELISA Kit
RD-SLN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Rat Sarcolipin (SLN) ELISA Kit
RDR-SLN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Sarcolipin (SLN) ELISA Kit
RDR-SLN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Sarcolipin (SLN) ELISA Kit
20-abx153017	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sarcolipin, SLN ELISA KIT
ELI-29539h	Lifescience Market	96 Tests	EUR 824

Human Sarcolipin(SLN)ELISA Kit
QY-E03004	Qayee Biotechnology	96T	EUR 361

Human Sarcolipin ELISA Kit (SLN)
RK02300	Abclonal	96 Tests	EUR 521

Human Sarcolipin (SLN) ELISA Kit
SEC848Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit
SEC848Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit
SEC848Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit
SEC848Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Human Sarcolipin (SLN) ELISA Kit
4-SEC848Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Sarcolipin (SLN) ELISA Kit
20-abx156065	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Sarcolipin, Sln ELISA KIT
ELI-18888r	Lifescience Market	96 Tests	EUR 886

Mouse Sarcolipin, Sln ELISA KIT
ELI-20144m	Lifescience Market	96 Tests	EUR 865

Rabbit Sarcolipin, SLN ELISA KIT
ELI-20145Ra	Lifescience Market	96 Tests	EUR 928

Rat Sarcolipin (SLN) ELISA Kit
SEC848Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit
SEC848Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit
SEC848Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit
SEC848Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Sarcolipin (SLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Sarcolipin (SLN) in Tissue homogenates and other biological fluids.

Rat Sarcolipin (SLN) ELISA Kit
4-SEC848Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sarcolipin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Sarcolipin (SLN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Sarcolipin ELISA Kit (SLN)
RK03952	Abclonal	96 Tests	EUR 521

Sarcolipin (SLN) Antibody
20-abx178309	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Sarcolipin (SLN) Antibody
20-abx178310	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Sarcolipin (SLN) Antibody
20-abx115382	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sarcolipin (SLN) Antibody
20-abx174457	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Sarcolipin (SLN) Antibody
20-abx174458	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Sarcolipin (SLN) Antibody
abx237987-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

ELISA kit for Human SLN (Sarcolipin)
ELK3935	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN). Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)
KTE60578-48T	Abbkine	48T	EUR 332
Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)
KTE60578-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sarcolipin (SLN)
KTE60578-96T	Abbkine	96T	EUR 539
Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever Show more
Description: Quantitative sandwich ELISA for measuring Human Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sarcolipin (SLN) CLIA Kit
20-abx493935	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Sarcolipin (SLN) Protein
20-abx654987	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Rat SLN (Sarcolipin)
ELK7068	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcolipin (SLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcolipin (SLN). Show more
Description: A sandwich ELISA kit for detection of Sarcolipin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)
KTE100238-48T	Abbkine	48T	EUR 332
Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)
KTE100238-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sarcolipin (SLN)
KTE100238-96T	Abbkine	96T	EUR 539
Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. Sarcolipin is a small proteolipid that regulates sever Show more
Description: Quantitative sandwich ELISA for measuring Rat Sarcolipin (SLN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Sarcolipin (SLN) CLIA Kit
20-abx493936	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Sarcolipin (SLN) Protein
20-abx654988	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

SLN ELISA KIT|Human
EF003037	Lifescience Market	96 Tests	EUR 689

SLN ELISA Kit (Human) (OKCD01707)
OKCD01707	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Reversibly inhibits the activity of ATP2A1 in sarcoplasmic reticulum by decreasing the apparent affinity of the ATPase for Ca2+. Modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. Required for muscle-based, non-shivering thermogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.121 ng/mL

SLN ELISA Kit (Rat) (OKDD00843)
OKDD00843	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: Reversibly inhibits the activity of atp2a1 in sarcoplasmic reticulum by decreasing the apparent affinity of the atpase for ca2+. modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in muscle. required for muscle-based, non-shivering thermogenesis (by similarity).;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.058ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

SLN antibody
70R-20378	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SLN antibody

SLN Antibody
1-CSB-PA021780GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLN. Recognizes SLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SLN siRNA
20-abx905135	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLN siRNA
20-abx934265	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLN siRNA
20-abx934266	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human SLN shRNA Plasmid
20-abx954475	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SLN Recombinant Protein (Human)
RP043588	ABM	100 ug	Ask for price

SLN Recombinant Protein (Human)
RP029320	ABM	100 ug	Ask for price

SLN cloning plasmid
CSB-CL021780HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 108 Sequence: atggtcctgggattgactgagatgctccggagctgcctgctctatgccctgagaccccactgctgtcattgtcacaggatgccattctccatccgagggcacctgtga
Description: A cloning plasmid for the SLN gene.

SLN cloning plasmid
CSB-CL021780HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 96 Sequence: ATGGGGATAAACACCCGGGAGCTGTTTCTCAACTTCACTATTGTCTTGATTACGGTTATTCTTATGTGGCTCCTTGTGAGGTCCTATCAGTACTGA
Description: A cloning plasmid for the SLN gene.

anti- SLN antibody
FNab07987	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 IF: 1:20-1:200 Immunogen: sarcolipin Uniprot ID: O00631 Gene ID: 6588 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against SLN

Anti-SLN antibody
PAab07987	Lifescience Market	100 ug	EUR 386

SLN ORF Vector (Human) (pORF)
ORF014530	ABM	1.0 ug DNA	EUR 354

SLN ORF Vector (Human) (pORF)
ORF009774	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat SLN shRNA Plasmid
20-abx990682	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SLN shRNA Plasmid
20-abx975588	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SLN Recombinant Protein (Rat)
RP229979	ABM	100 ug	Ask for price

SLN Recombinant Protein (Mouse)
RP173738	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SLN sgRNA CRISPR Lentivector set (Human)
K2196901	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Sln ORF Vector (Rat) (pORF)
ORF076661	ABM	1.0 ug DNA	EUR 506

Sln ORF Vector (Mouse) (pORF)
ORF057914	ABM	1.0 ug DNA	EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

SLN sgRNA CRISPR Lentivector (Human) (Target 1)
K2196902	ABM	1.0 ug DNA	EUR 154

SLN sgRNA CRISPR Lentivector (Human) (Target 2)
K2196903	ABM	1.0 ug DNA	EUR 154

SLN sgRNA CRISPR Lentivector (Human) (Target 3)
K2196904	ABM	1.0 ug DNA	EUR 154

SLN Protein Vector (Human) (pPB-C-His)
PV058117	ABM	500 ng	EUR 481

SLN Protein Vector (Human) (pPB-N-His)
PV058118	ABM	500 ng	EUR 481

SLN Protein Vector (Human) (pPM-C-HA)
PV058119	ABM	500 ng	EUR 481

SLN Protein Vector (Human) (pPM-C-His)
PV058120	ABM	500 ng	EUR 481

SLN Protein Vector (Human) (pPB-C-His)
PV039093	ABM	500 ng	EUR 329

SLN Protein Vector (Human) (pPB-N-His)
PV039094	ABM	500 ng	EUR 329

SLN Protein Vector (Human) (pPM-C-HA)
PV039095	ABM	500 ng	EUR 329

SLN Protein Vector (Human) (pPM-C-His)
PV039096	ABM	500 ng	EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

SLN Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702969	ABM	1.0 ug DNA	EUR 450

SLN Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702973	ABM	1.0 ug DNA	EUR 450

SLN Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702974	ABM	1.0 ug DNA	EUR 450

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Sln sgRNA CRISPR Lentivector set (Rat)
K6259301	ABM	3 x 1.0 ug	EUR 339

Sln sgRNA CRISPR Lentivector set (Mouse)
K4052401	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

Sln sgRNA CRISPR Lentivector (Rat) (Target 1)
K6259302	ABM	1.0 ug DNA	EUR 154

Sln sgRNA CRISPR Lentivector (Rat) (Target 2)
K6259303	ABM	1.0 ug DNA	EUR 154

Sln sgRNA CRISPR Lentivector (Rat) (Target 3)
K6259304	ABM	1.0 ug DNA	EUR 154

Sln sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4052402	ABM	1.0 ug DNA	EUR 154

Sln sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4052403	ABM	1.0 ug DNA	EUR 154

Sln sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4052404	ABM	1.0 ug DNA	EUR 154

SLN Protein Vector (Rat) (pPB-C-His)
PV306642	ABM	500 ng	EUR 603

SLN Protein Vector (Rat) (pPB-N-His)
PV306643	ABM	500 ng	EUR 603

SLN Protein Vector (Rat) (pPM-C-HA)
PV306644	ABM	500 ng	EUR 603

SLN Protein Vector (Rat) (pPM-C-His)
PV306645	ABM	500 ng	EUR 603

SLN Protein Vector (Mouse) (pPB-C-His)
PV231654	ABM	500 ng	EUR 603

Human SLN(Sarcolipin) ELISA Kit