Human SYNC(Syncoilin) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Syncoilin (SYNC) ELISA Kit

RDR-SYNC-Hu-48Tests 48 Tests
EUR 544

Human Syncoilin (SYNC) ELISA Kit

RDR-SYNC-Hu-96Tests 96 Tests
EUR 756

Human Syncoilin, SYNC ELISA KIT

ELI-53119h 96 Tests
EUR 824

Human Syncoilin (SYNC) ELISA Kit

20-abx153203
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Syncoilin(SYNC)ELISA Kit

QY-E00204 96T
EUR 361

Human Syncoilin (SYNC) ELISA Kit

SEF891Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit

SEF891Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit

SEF891Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit

SEF891Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit

4-SEF891Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Syncoilin elisa. Alternative names of the recognized antigen: Syncoilin-1
  • Intermediate Filament Protein
  • Syncoilin intermediate filament 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncoilin (SYNC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Syncoilin (SYNC) Antibody

20-abx128347
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Syncoilin (SYNC) Antibody

20-abx174693
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Syncoilin (SYNC) Antibody

20-abx310668
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody

abx238433-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Syncoilin (SYNC)

4-RPF891Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H7C4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Syncoilin expressed in: E.coli

Mouse Syncoilin, Sync ELISA KIT

ELI-41064m 96 Tests
EUR 865

Human Syncoilin (SYNC) Protein

20-abx166532
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human SYNC (Syncoilin)

ELK3923 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncoilin (SYNC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncoilin (SYNC).
  • Show more
Description: A sandwich ELISA kit for detection of Syncoilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)

KTE60412-48T 48T
EUR 332
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)

KTE60412-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)

KTE60412-96T 96T
EUR 539
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Syncoilin (SYNC) CLIA Kit

20-abx495048
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse Syncoilin (SYNC)

KTE70284-48T 48T
EUR 332
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)

KTE70284-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)

KTE70284-96T 96T
EUR 539
  • Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syncoilin (SYNC) Antibody (HRP)

20-abx310669
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (FITC)

20-abx310670
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (Biotin)

20-abx310671
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine)

4-PAF891Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC)

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC

4-PAF891Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Biotinylated

4-PAF891Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Biotin.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Cy3

4-PAF891Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Cy3.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), FITC

4-PAF891Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with FITC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), HRP

4-PAF891Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with HRP.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), PE

4-PAF891Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with PE.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC-Cy7

4-PAF891Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SYNC (Ile169~Pro458)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC-Cy7.

SYNC ELISA KIT|Human

EF003394 96 Tests
EUR 689

SYNC ELISA Kit (Human) (OKCD00987)

OKCD00987 96 Wells
EUR 831
Description: Description of target: Atypical type III intermediate filament (IF) protein that may play a supportive role in the efficient coupling of mechanical stress between the myofibril and fiber exterior. May facilitate lateral force transmission during skeletal muscle contraction. Does not form homofilaments nor heterofilaments with other IF proteins.By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:Q9EPM5 (SYNCI_MOUSE) ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

SYNC siRNA

20-abx935788
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYNC siRNA

20-abx935789
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYNC Antibody

1-CSB-PA862034LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human SYNC shRNA Plasmid

20-abx962976
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sync Recombinant Protein (Human)

RP043876 100 ug Ask for price

anti- SYNC antibody

FNab08433 100µg
EUR 548.75
  • Immunogen: syncoilin, intermediate filament protein
  • Uniprot ID: Q9H7C4
  • Research Area: Neuroscience
Description: Antibody raised against SYNC

SYNC Polyclonal Antibody

A67194 100 µg
EUR 570.55
Description: The best epigenetics products

SYNC cloning plasmid

CSB-CL862034HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: ATGGCAGAGAGCCGCCAGGACCTGGAGGAGGAGTATGAGCCTCAGTTCCTGCGGCTCCTAGAGAGGAAAGAAGCTGGGACCAAAGCTCTGCAGAGAACCCAGGCTGAGATCCAGGAAATGAAGGAGGCTCTGAGACCCCTGCAAGCAGAGGCCCGGCAGCTCCGCCTGCAAAACAG
  • Show more
Description: A cloning plasmid for the SYNC gene.

Anti-SYNC antibody

PAab08433 100 ug
EUR 386

SYNC ORF Vector (Human) (pORF)

ORF014626 1.0 ug DNA
EUR 354

Mouse SYNC shRNA Plasmid

20-abx976752
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYNC Antibody, HRP conjugated

1-CSB-PA862034LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SYNC Antibody, FITC conjugated

1-CSB-PA862034LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SYNC Antibody, Biotin conjugated

1-CSB-PA862034LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Sync Recombinant Protein (Rat)

RP231893 100 ug Ask for price

Sync Recombinant Protein (Mouse)

RP176738 100 ug Ask for price

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SYNC sgRNA CRISPR Lentivector set (Human)

K2320201 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

SYNC Polyclonal Antibody, HRP Conjugated

A67195 100 µg
EUR 570.55
Description: kits suitable for this type of research

SYNC Polyclonal Antibody, FITC Conjugated

A67196 100 µg
EUR 570.55
Description: fast delivery possible

SYNC Polyclonal Antibody, Biotin Conjugated

A67197 100 µg
EUR 570.55
Description: reagents widely cited

Sync ORF Vector (Mouse) (pORF)

ORF058914 1.0 ug DNA
EUR 506

Sync ORF Vector (Rat) (pORF)

ORF077299 1.0 ug DNA
EUR 506

SYNC sgRNA CRISPR Lentivector (Human) (Target 1)

K2320202 1.0 ug DNA
EUR 154

SYNC sgRNA CRISPR Lentivector (Human) (Target 2)

K2320203 1.0 ug DNA
EUR 154

SYNC sgRNA CRISPR Lentivector (Human) (Target 3)

K2320204 1.0 ug DNA
EUR 154

Sync Protein Vector (Human) (pPB-C-His)

PV058501 500 ng
EUR 481

Sync Protein Vector (Human) (pPB-N-His)

PV058502 500 ng
EUR 481

Sync Protein Vector (Human) (pPM-C-HA)

PV058503 500 ng
EUR 481

Sync Protein Vector (Human) (pPM-C-His)

PV058504 500 ng
EUR 481

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Polyclonal SYNC antibody - N-terminal region

AMM08057G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYNC - N-terminal region. This antibody is tested and proven to work in the following applications:

Sync sgRNA CRISPR Lentivector set (Mouse)

K4014401 3 x 1.0 ug
EUR 339

Sync sgRNA CRISPR Lentivector set (Rat)

K6600001 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Sync sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4014402 1.0 ug DNA
EUR 154

Sync sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4014403 1.0 ug DNA
EUR 154

Sync sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4014404 1.0 ug DNA
EUR 154

Sync sgRNA CRISPR Lentivector (Rat) (Target 1)

K6600002 1.0 ug DNA
EUR 154

Sync sgRNA CRISPR Lentivector (Rat) (Target 2)

K6600003 1.0 ug DNA
EUR 154

Sync sgRNA CRISPR Lentivector (Rat) (Target 3)

K6600004 1.0 ug DNA
EUR 154

Sync Protein Vector (Rat) (pPB-C-His)

PV309194 500 ng
EUR 603

Sync Protein Vector (Rat) (pPB-N-His)

PV309195 500 ng
EUR 603

Sync Protein Vector (Rat) (pPM-C-HA)

PV309196 500 ng
EUR 603

Sync Protein Vector (Rat) (pPM-C-His)

PV309197 500 ng
EUR 603

Sync Protein Vector (Mouse) (pPB-C-His)

PV235654 500 ng
EUR 603

Sync Protein Vector (Mouse) (pPB-N-His)

PV235655 500 ng
EUR 603

Sync Protein Vector (Mouse) (pPM-C-HA)

PV235656 500 ng
EUR 603

Sync Protein Vector (Mouse) (pPM-C-His)

PV235657 500 ng
EUR 603

Sync 3'UTR GFP Stable Cell Line

TU170013 1.0 ml Ask for price

Sync 3'UTR Luciferase Stable Cell Line

TU120013 1.0 ml Ask for price

SYNC 3'UTR GFP Stable Cell Line

TU074997 1.0 ml
EUR 1521

SYNC 3'UTR Luciferase Stable Cell Line

TU024997 1.0 ml
EUR 1521

Sync 3'UTR Luciferase Stable Cell Line

TU221460 1.0 ml Ask for price

Sync 3'UTR GFP Stable Cell Line

TU271460 1.0 ml Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2320205 3 x 1.0 ug
EUR 376

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2320206 1.0 ug DNA
EUR 167

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2320207 1.0 ug DNA
EUR 167

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2320208 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4014405 3 x 1.0 ug
EUR 376

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6600005 3 x 1.0 ug
EUR 376

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4014406 1.0 ug DNA
EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4014407 1.0 ug DNA
EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4014408 1.0 ug DNA
EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6600006 1.0 ug DNA
EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6600007 1.0 ug DNA
EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6600008 1.0 ug DNA
EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit

ELA-E0121h 96 Tests
EUR 824

Human KIT/SCFR ELISA kit

LF-EK50791 1×96T
EUR 648

KIT ELISA Kit (Human) (OKAN04574)

OKAN04574 96 Wells
EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)

OKCD06003 96 Wells
EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Biopterin ELISA Kit

CELI-66011h 96 Tests
EUR 824

Human lipopolysaccharides ELISA Kit

CELI-66031h 96 Tests
EUR 824

Human Microlbumin ELISA Kit

abx517025-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Trypsin ELISA kit

E01T0139-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Trypsin ELISA kit

E01T0139-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit

E01T0140-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit

E01T0140-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tryptophane ELISA kit

E01T0140-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thyroglobulin ELISA kit

E01T0141-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SYNC(Syncoilin) ELISA Kit