Human SYNC(Syncoilin) ELISA Kit 

To Order Contact us: stephen@expresspharmapulse.com

Human Syncoilin (SYNC) ELISA Kit
RDR-SYNC-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Syncoilin (SYNC) ELISA Kit
RDR-SYNC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Syncoilin (SYNC) ELISA Kit
20-abx153203	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Syncoilin, SYNC ELISA KIT
ELI-53119h	Lifescience Market	96 Tests	EUR 824

Human Syncoilin(SYNC)ELISA Kit
QY-E00204	Qayee Biotechnology	96T	EUR 361

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
4-SEF891Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Syncoilin elisa. Alternative names of the recognized antigen: Syncoilin-1 Intermediate Filament Protein Syncoilin intermediate filament 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncoilin (SYNC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Syncoilin (SYNC) Antibody
20-abx128347	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Syncoilin (SYNC) Antibody
20-abx174693	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Syncoilin (SYNC) Antibody
abx238433-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Syncoilin (SYNC) Antibody
20-abx310668	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Syncoilin (SYNC)
4-RPF891Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H7C4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 64.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Syncoilin expressed in: E.coli

Mouse Syncoilin, Sync ELISA KIT
ELI-41064m	Lifescience Market	96 Tests	EUR 865

Human Syncoilin (SYNC) Protein
20-abx166532	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Human SYNC (Syncoilin)
ELK3923	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncoilin (SYNC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncoilin (SYNC). Show more
Description: A sandwich ELISA kit for detection of Syncoilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-48T	Abbkine	48T	EUR 332
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-96T	Abbkine	96T	EUR 539
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Syncoilin (SYNC) CLIA Kit
20-abx495048	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-48T	Abbkine	48T	EUR 332
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-96T	Abbkine	96T	EUR 539
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syncoilin (SYNC) Antibody (HRP)
20-abx310669	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (FITC)
20-abx310670	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (Biotin)
20-abx310671	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine)
4-PAF891Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC)

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC
4-PAF891Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Biotinylated
4-PAF891Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Biotin.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Cy3
4-PAF891Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Cy3.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), FITC
4-PAF891Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with FITC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), HRP
4-PAF891Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with HRP.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), PE
4-PAF891Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with PE.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC-Cy7
4-PAF891Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC-Cy7.

SYNC ELISA KIT|Human
EF003394	Lifescience Market	96 Tests	EUR 689

SYNC ELISA Kit (Human) (OKCD00987)
OKCD00987	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Atypical type III intermediate filament (IF) protein that may play a supportive role in the efficient coupling of mechanical stress between the myofibril and fiber exterior. May facilitate lateral force transmission during skeletal muscle contraction. Does not form homofilaments nor heterofilaments with other IF proteins.By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:Q9EPM5 (SYNCI_MOUSE) ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

SYNC Antibody
1-CSB-PA862034LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Unconjugated. Tested in the following application: ELISA

SYNC siRNA
20-abx935788	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNC siRNA
20-abx935789	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human SYNC shRNA Plasmid
20-abx962976	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Sync Recombinant Protein (Human)
RP043876	ABM	100 ug	Ask for price

SYNC cloning plasmid
CSB-CL862034HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 456 Sequence: ATGGCAGAGAGCCGCCAGGACCTGGAGGAGGAGTATGAGCCTCAGTTCCTGCGGCTCCTAGAGAGGAAAGAAGCTGGGACCAAAGCTCTGCAGAGAACCCAGGCTGAGATCCAGGAAATGAAGGAGGCTCTGAGACCCCTGCAAGCAGAGGCCCGGCAGCTCCGCCTGCAAAACAG Show more
Description: A cloning plasmid for the SYNC gene.

SYNC Polyclonal Antibody
A67194	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

anti- SYNC antibody
FNab08433	FN Test	100µg	EUR 548.75
Immunogen: syncoilin, intermediate filament protein Uniprot ID: Q9H7C4 Research Area: Neuroscience
Description: Antibody raised against SYNC

Anti-SYNC antibody
PAab08433	Lifescience Market	100 ug	EUR 386

SYNC ORF Vector (Human) (pORF)
ORF014626	ABM	1.0 ug DNA	EUR 354

SYNC Antibody, HRP conjugated
1-CSB-PA862034LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SYNC Antibody, FITC conjugated
1-CSB-PA862034LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SYNC Antibody, Biotin conjugated
1-CSB-PA862034LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse SYNC shRNA Plasmid
20-abx976752	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Sync Recombinant Protein (Rat)
RP231893	ABM	100 ug	Ask for price

Sync Recombinant Protein (Mouse)
RP176738	ABM	100 ug	Ask for price

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

SYNC sgRNA CRISPR Lentivector set (Human)
K2320201	ABM	3 x 1.0 ug	EUR 339

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

SYNC Polyclonal Antibody, HRP Conjugated
A67195	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SYNC Polyclonal Antibody, FITC Conjugated
A67196	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SYNC Polyclonal Antibody, Biotin Conjugated
A67197	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Sync ORF Vector (Rat) (pORF)
ORF077299	ABM	1.0 ug DNA	EUR 506

Sync ORF Vector (Mouse) (pORF)
ORF058914	ABM	1.0 ug DNA	EUR 506

SYNC sgRNA CRISPR Lentivector (Human) (Target 1)
K2320202	ABM	1.0 ug DNA	EUR 154

SYNC sgRNA CRISPR Lentivector (Human) (Target 2)
K2320203	ABM	1.0 ug DNA	EUR 154

SYNC sgRNA CRISPR Lentivector (Human) (Target 3)
K2320204	ABM	1.0 ug DNA	EUR 154

Sync Protein Vector (Human) (pPB-C-His)
PV058501	ABM	500 ng	EUR 481

Sync Protein Vector (Human) (pPB-N-His)
PV058502	ABM	500 ng	EUR 481

Sync Protein Vector (Human) (pPM-C-HA)
PV058503	ABM	500 ng	EUR 481

Sync Protein Vector (Human) (pPM-C-His)
PV058504	ABM	500 ng	EUR 481

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Polyclonal SYNC antibody - N-terminal region
AMM08057G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYNC - N-terminal region. This antibody is tested and proven to work in the following applications:

Sync sgRNA CRISPR Lentivector set (Rat)
K6600001	ABM	3 x 1.0 ug	EUR 339

Sync sgRNA CRISPR Lentivector set (Mouse)
K4014401	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Sync sgRNA CRISPR Lentivector (Rat) (Target 1)
K6600002	ABM	1.0 ug DNA	EUR 154

Sync sgRNA CRISPR Lentivector (Rat) (Target 2)
K6600003	ABM	1.0 ug DNA	EUR 154

Sync sgRNA CRISPR Lentivector (Rat) (Target 3)
K6600004	ABM	1.0 ug DNA	EUR 154

Sync sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4014402	ABM	1.0 ug DNA	EUR 154

Sync sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4014403	ABM	1.0 ug DNA	EUR 154

Sync sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4014404	ABM	1.0 ug DNA	EUR 154

Sync Protein Vector (Rat) (pPB-C-His)
PV309194	ABM	500 ng	EUR 603

Sync Protein Vector (Rat) (pPB-N-His)
PV309195	ABM	500 ng	EUR 603

Sync Protein Vector (Rat) (pPM-C-HA)
PV309196	ABM	500 ng	EUR 603

Sync Protein Vector (Rat) (pPM-C-His)
PV309197	ABM	500 ng	EUR 603

Sync Protein Vector (Mouse) (pPB-C-His)
PV235654	ABM	500 ng	EUR 603

Sync Protein Vector (Mouse) (pPB-N-His)
PV235655	ABM	500 ng	EUR 603

Sync Protein Vector (Mouse) (pPM-C-HA)
PV235656	ABM	500 ng	EUR 603

Sync Protein Vector (Mouse) (pPM-C-His)
PV235657	ABM	500 ng	EUR 603

Sync 3'UTR Luciferase Stable Cell Line
TU120013	ABM	1.0 ml	Ask for price

Sync 3'UTR GFP Stable Cell Line
TU170013	ABM	1.0 ml	Ask for price

Sync 3'UTR Luciferase Stable Cell Line
TU221460	ABM	1.0 ml	Ask for price

SYNC 3'UTR GFP Stable Cell Line
TU074997	ABM	1.0 ml	EUR 1521

Sync 3'UTR GFP Stable Cell Line
TU271460	ABM	1.0 ml	Ask for price

SYNC 3'UTR Luciferase Stable Cell Line
TU024997	ABM	1.0 ml	EUR 1521

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2320205	ABM	3 x 1.0 ug	EUR 376

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2320206	ABM	1.0 ug DNA	EUR 167

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2320207	ABM	1.0 ug DNA	EUR 167

SYNC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2320208	ABM	1.0 ug DNA	EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6600005	ABM	3 x 1.0 ug	EUR 376

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4014405	ABM	3 x 1.0 ug	EUR 376

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6600006	ABM	1.0 ug DNA	EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6600007	ABM	1.0 ug DNA	EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6600008	ABM	1.0 ug DNA	EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4014406	ABM	1.0 ug DNA	EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4014407	ABM	1.0 ug DNA	EUR 167

Sync sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4014408	ABM	1.0 ug DNA	EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h	Lifescience Market	96 Tests	EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791	Abfrontier	1×96T	EUR 648

KIT ELISA Kit (Human) (OKAN04574)
OKAN04574	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)
OKCD06003	Aviva Systems Biology	96 Wells	EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Pentosidine ELISA Kit
201-12-0005	SunredBio	96 tests	EUR 440
This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit
201-12-0017	SunredBio	96 tests	EUR 440
This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit
201-12-0026	SunredBio	96 tests	EUR 440
This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Secretin ELISA Kit
201-12-0027	SunredBio	96 tests	EUR 440
This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human omentin ELISA Kit
201-12-0156	SunredBio	96 tests	EUR 440
This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human Resistin ELISA KIT
201-12-0339	SunredBio	96 tests	EUR 440
This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Collectin ELISA Kit
201-12-0354	SunredBio	96 tests	EUR 440
This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Agrin ELISA Kit
201-12-0414	SunredBio	96 tests	EUR 440
This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thymosin ELISA Kit
201-12-0416	SunredBio	96 tests	EUR 440
This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human talin ELISA Kit
201-12-0620	SunredBio	96 tests	EUR 440
This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human SYNC(Syncoilin) ELISA Kit