Insulin (large) R1: 2×13.5ml 

To Order Contact us: stephen@expresspharmapulse.com

Ginsenoside R1

TBW01039 20mg Ask for price

Zingibroside R1

TBZ2642 20mg Ask for price

Notoginsenoside R1

TN02805 25mg Ask for price

Stipuleanoside R1

TBZ0899 unit Ask for price

Rathbunioside R1

TBZ2265 unit Ask for price

Antigen-Antibody Pen For Rabbit Primary antibodies

PEN-R1 1
EUR 202

IFNGamma R1/ Rat IFNGamma R1 ELISA Kit

ELA-E0420r 96 Tests
EUR 886

Njmu-R1 antibody

22401-100ul 100ul
EUR 390

TNF R1 antibody

20R-1464 100 ug
EUR 673
Description: Rabbit polyclonal TNF R1 antibody

TNF-R1 Antibody

3125-100
EUR 354

TNF-R1 Antibody

3125-30T
EUR 146

TNF R1 antibody

70R-12323 100 ug
EUR 403
Description: Rabbit polyclonal TNF R1 antibody

TNF-R1 Antibody

32304-100ul 100ul
EUR 252

TNF-R1 Antibody

5348-100
EUR 316

TNF-R1 Antibody

5348-30T
EUR 146

TNF-R1 Antibody

DF6447 200ul
EUR 304
Description: TNF-R1 Antibody detects endogenous levels of total TNF-R1.

sigma R1 Antibody

20-abx004198
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gingipain R1 Antibody

20-abx109432
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

sigma R1 siRNA

20-abx904935
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PACAP-R1 Antibody

20-abx225015
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

sigma R1 siRNA

20-abx933365
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

sigma R1 siRNA

20-abx933366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNF- R1 Antibody

ABD6447 100 ug
EUR 438

TRAIL R1/CD261

GT15061 100 ug
EUR 526

LARGE antibody

70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE

LARGE siRNA

20-abx922269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARGE siRNA

20-abx922270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGF beta R1 antibody

20R-1832 100 ug
EUR 673
Description: Rabbit polyclonal TGF beta R1 antibody

TNF-R1 Blocking Peptide

3125BP-50
EUR 153

IFN alpha R1 Antibody

48307-100ul 100ul
EUR 333

IFN alpha R1 Antibody

48307-50ul 50ul
EUR 239

TNF R1 Blocking Peptide

33R-10452 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNF R1 antibody, catalog no. 20R-1464

GABAB R1 Polyclonal Antibody

40945-100ul 100ul
EUR 252

GABAB R1 Polyclonal Antibody

40945-50ul 50ul
EUR 187

Polyclonal TNF-R1 Antibody

APR00027G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNF-R1 . This antibody is tested and proven to work in the following applications:

Polyclonal TNF-R1 Antibody

APR00285G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNF-R1 . This antibody is tested and proven to work in the following applications:

TNF-R1 Blocking Peptide

DF6447-BP 1mg
EUR 195

Gingipain R1 Antibody (Biotin)

20-abx106354
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gingipain R1 Antibody (FITC)

20-abx107767
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gingipain R1 Antibody (HRP)

20-abx109184
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TNF-R1 Conjugated Antibody

C32304 100ul
EUR 397

TNF-R1 Antibody (Biotin)

abx446691-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

TNF-R1 Antibody (FITC)

abx446693-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

TNF-R1 Antibody (HRP)

abx446695-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

GABAB R1 Polyclonal Antibody

ABP54428-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950

GABAB R1 Polyclonal Antibody

ABP54428-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950

GABAB R1 Polyclonal Antibody

ABP54428-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950

GABAB R1 Polyclonal Antibody

ABP51390-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920

GABAB R1 Polyclonal Antibody

ABP51390-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920

GABAB R1 Polyclonal Antibody

ABP51390-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920
  • Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920

TNF-R1 Polyclonal Antibody

ABP56405-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430

TNF-R1 Polyclonal Antibody

ABP56405-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430

TNF-R1 Polyclonal Antibody

ABP56405-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430

TRH-R1 Polyclonal Antibody

ABP56447-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250

TRH-R1 Polyclonal Antibody

ABP56447-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250

TRH-R1 Polyclonal Antibody

ABP56447-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250

TNF-R1 Polyclonal Antibody

ES7404-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TNF-R1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

TNF-R1 Polyclonal Antibody

ES7404-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TNF-R1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

TRH-R1 Polyclonal Antibody

ES7446-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRH-R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

TRH-R1 Polyclonal Antibody

ES7446-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRH-R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GABAB R1 Polyclonal Antibody

ES5427-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GABAB R1 Polyclonal Antibody

ES5427-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GABAB R1 Polyclonal Antibody

ES2389-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

GABAB R1 Polyclonal Antibody

ES2389-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IL-1 R1/CD121a

GT15109 100 ug
EUR 526

Anti-GABAB R1 antibody

STJ93193 200 µl
EUR 197
Description: Rabbit polyclonal to GABAB R1.

Anti-GABAB R1 antibody

STJ93194 200 µl
EUR 197
Description: Rabbit polyclonal to GABAB R1.

Anti-TNF-R1 antibody

STJ96052 200 µl
EUR 197
Description: Rabbit polyclonal to TNF-R1.

Anti-TRH-R1 antibody

STJ96099 200 µl
EUR 197
Description: Rabbit polyclonal to TRH-R1.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE

EF012373 96 Tests
EUR 689

LARGE Blocking Peptide

33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Large-CRP OmcBProtein

20-abx600013
  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

20-abx600014
  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

LARGE cloning plasmid

CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.

LARGE Rabbit pAb

A19515-100ul 100 ul Ask for price

LARGE Rabbit pAb

A19515-200ul 200 ul Ask for price

LARGE Rabbit pAb

A19515-20ul 20 ul Ask for price

LARGE Rabbit pAb

A19515-50ul 50 ul
EUR 308

anti- LARGE antibody

FNab04697 100µg
EUR 548.75
  • Immunogen: like-glycosyltransferase
  • Uniprot ID: O95461
  • Gene ID: 9215
  • Research Area: Metabolism
Description: Antibody raised against LARGE

Anti-LARGE antibody

PAab04697 100 ug
EUR 386

Anti-LARGE antibody

STJ11100708 50 µl
EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.

Spatulas (Large Pack)

SPAT1 50pack
EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.

GABBR1 antibody (Ser923) (R1-Subunit)

70R-14994 100 ul
EUR 392
Description: Rabbit polyclonal GABBR1 antibody (Ser923) (R1-Subunit)

Anti-CD93/C1Q R1 Antibody

A04939 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CD93 Antibody (CD93) detection. Tested with WB in Human.

Porphyromonas gingivalis Gingipain R1 (rgpA)

1-CSB-MP338957PQP
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 58 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in Mammalian cell

Porphyromonas gingivalis Gingipain R1 (rgpA)

1-CSB-EP338957PQP
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 68 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in E.coli

Porphyromonas gingivalis Gingipain R1 (rgpA)

1-CSB-YP338957PQP
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 56 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in Yeast

Human TRAIL R1 ELISA Kit

EHT0546 96Tests
EUR 521

Human NMDA-R1 ELISA Kit

EHN0034 96Tests
EUR 521

Human STRAIL-R1 ELISA Kit

EHS0303 96Tests
EUR 521

Bovine NMDA-R1 ELISA Kit

EBN0034 96Tests
EUR 521

Bovine STRAIL-R1 ELISA Kit

EBS0303 96Tests
EUR 521

Bovine TRAIL R1 ELISA Kit

EBT0546 96Tests
EUR 521

Anserine NMDA-R1 ELISA Kit

EAN0034 96Tests
EUR 521

Anserine STRAIL-R1 ELISA Kit

EAS0303 96Tests
EUR 521

Anserine TRAIL R1 ELISA Kit

EAT0546 96Tests
EUR 521

Chicken NMDA-R1 ELISA Kit

ECKN0034 96Tests
EUR 521

Canine NMDA-R1 ELISA Kit

ECN0034 96Tests
EUR 521

Canine STRAIL-R1 ELISA Kit

ECS0303 96Tests
EUR 521

Canine TRAIL R1 ELISA Kit

ECT0546 96Tests
EUR 521

Goat NMDA-R1 ELISA Kit

EGTN0034 96Tests
EUR 521

Goat STRAIL-R1 ELISA Kit

EGTS0303 96Tests
EUR 521

Goat TRAIL R1 ELISA Kit

EGTT0546 96Tests
EUR 521

IFN alpha R1 Conjugated Antibody

C48307 100ul
EUR 397

Porcine NMDA-R1 ELISA Kit

EPN0034 96Tests
EUR 521

Porcine STRAIL-R1 ELISA Kit

EPS0303 96Tests
EUR 521

Porcine TRAIL R1 ELISA Kit

EPT0546 96Tests
EUR 521

Sheep NMDA-R1 ELISA Kit

ESN0034 96Tests
EUR 521

Rat NMDA-R1 ELISA Kit

ERN0034 96Tests
EUR 521

Rat STRAIL-R1 ELISA Kit

ERS0303 96Tests
EUR 521

Rat TRAIL R1 ELISA Kit

ERT0546 96Tests
EUR 521

Rabbit NMDA-R1 ELISA Kit

ERTN0034 96Tests
EUR 521

Rabbit STRAIL-R1 ELISA Kit

ERTS0303 96Tests
EUR 521

Rabbit TRAIL R1 ELISA Kit

ERTT0546 96Tests
EUR 521

Monkey NMDA-R1 ELISA Kit

EMKN0034 96Tests
EUR 521

Mouse NMDA-R1 ELISA Kit

EMN0034 96Tests
EUR 521

Mouse STRAIL-R1 ELISA Kit

EMS0303 96Tests
EUR 521

Mouse TRAIL R1 ELISA Kit

EMT0546 96Tests
EUR 521

Recombinant Human CD200 R1 Protein

RP00837 10 μg
EUR 164

Antibody for Mouse TNF-R1

SPC-170D 0.1mg
EUR 336
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is unconjugated.

Antibody for Mouse TNF-R1

SPC-170D-A390 0.1mg
EUR 383
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 390.

Antibody for Mouse TNF-R1

SPC-170D-A488 0.1mg
EUR 382
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 488.

Antibody for Mouse TNF-R1

SPC-170D-A565 0.1mg
EUR 382
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 565.

Antibody for Mouse TNF-R1

SPC-170D-A594 0.1mg
EUR 382
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 594.

Antibody for Mouse TNF-R1

SPC-170D-A633 0.1mg
EUR 382
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 633.

Antibody for Mouse TNF-R1

SPC-170D-A655 0.1mg
EUR 382
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 655.

Antibody for Mouse TNF-R1

SPC-170D-A680 0.1mg
EUR 382
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 680.

Antibody for Mouse TNF-R1

SPC-170D-A700 0.1mg
EUR 382
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 700.

Antibody for Mouse TNF-R1

SPC-170D-ALP 0.1mg
EUR 376
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Alkaline Phosphatase.

Antibody for Mouse TNF-R1

SPC-170D-APC 0.1mg
EUR 381
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to APC .

Antibody for Mouse TNF-R1

SPC-170D-APCCY7 0.1mg
EUR 454
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to APC/Cy7.

Antibody for Mouse TNF-R1

SPC-170D-BI 0.1mg
EUR 378
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Biotin.

Antibody for Mouse TNF-R1

SPC-170D-DY350 0.1mg
EUR 397
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 350.

Antibody for Mouse TNF-R1

SPC-170D-DY405 0.1mg
EUR 385
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 405.

Antibody for Mouse TNF-R1

SPC-170D-DY488 0.1mg
EUR 375
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 488.

Antibody for Mouse TNF-R1

SPC-170D-DY594 0.1mg
EUR 377
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 594.

Antibody for Mouse TNF-R1

SPC-170D-DY633 0.1mg
EUR 372
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 633.

Antibody for Mouse TNF-R1

SPC-170D-FITC 0.1mg
EUR 374
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to FITC.

Antibody for Mouse TNF-R1

SPC-170D-HRP 0.1mg
EUR 370
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to HRP.

Antibody for Mouse TNF-R1

SPC-170D-P594 0.1mg
EUR 389
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to PE/ATTO 594.

Antibody for Mouse TNF-R1

SPC-170D-PCP 0.1mg
EUR 381
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to PerCP.

Antibody for Mouse TNF-R1

SPC-170D-RPE 0.1mg
EUR 379
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to RPE .

Antibody for Mouse TNF-R1

SPC-170D-STR 0.1mg
EUR 380
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Streptavidin.

Antibody for Mouse TNF-R1

SPC-170S 0.012mg
EUR 65
  • The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the
  • Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is unconjugated.

Anti-Mouse SIGN-R1 antibody

STJ16100766 100 µg
EUR 720

Immortalized Drosophila Embryonic Cells (R1)

T0701 1x106 cells / 1.0 ml Ask for price

Anti-NMUR1/Neuromedin U R1 Antibody

A09256 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NMUR1 Antibody (NMUR1) detection.tested for WB in Human.

Anti-C1q R1/CD93 Polyclonal Antibody

CTA-371-100ug 100ug Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

Anti-C1q R1/CD93 Polyclonal Antibody

CTA-371-1mg 1mg Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

SheepAnti-C1q R1/CD93 Polyclonal Antibody

CTA-374-100ug 100ug Ask for price
Description: Sheep mouse anti-C1q R1/CD93 polyclonal antibodyfor WB.

SheepAnti-C1q R1/CD93 Polyclonal Antibody

CTA-374-1mg 1mg Ask for price
Description: Sheep mouse anti-C1q R1/CD93 polyclonal antibodyfor WB.

Forkhead Box Protein R1 (FOXR1) Antibody

20-abx007921
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Forkhead Box Protein R1 (FoxR1) Antibody

20-abx215461
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig NMDA-R1 ELISA Kit

EGN0034 96Tests
EUR 521

Guinea Pig STRAIL-R1 ELISA Kit

EGS0303 96Tests
EUR 521

Guinea Pig TRAIL R1 ELISA Kit

EGT0546 96Tests
EUR 521

IFN‑gamma R1/CD119(Fc fusion)

E21-K43 10ug
EUR 343

Forkhead Box Protein R1 (FOXR1) Antibody

abx233212-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Forkhead Box Protein R1 (FOXR1) Antibody

20-abx325833
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Phospho-GABAB R1 (Ser923) Antibody

P07297 100ul
EUR 398
Description: Rabbit Polyclonal Phospho-GABAB R1 (Ser923) Antibody. Validated in WB and tested in Mouse, Rat.

Recombinant human FGF R1/CD331 Protein

RP01151 10 μg
EUR 155

Recombinant Human C1q R1/CD93 Protein

RP00845 10 μg
EUR 183

Caspase-12 Antibody (Large)

24208-100ul 100ul
EUR 390

Like Glycosyltransferase (LARGE) Antibody

20-abx124463
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

20-abx128114
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rubisco Large Chain Antibody

20-abx134717
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody

20-abx159680
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody

20-abx159681
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chicken LARGE ELISA KIT

ELI-08774c 96 Tests
EUR 928

LARGE ELISA KIT|Human

EF010620 96 Tests
EUR 689

Like Glycosyltransferase (LARGE) Antibody

abx234697-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Rubisco Antibody (Large Chain)

abx332842-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Large-CRP OmcB Protein

20-abx600002
  • EUR 1970.00
  • EUR 3919.00
  • EUR 2541.00
  • EUR 1414.00
  • 100 ug
  • 1 mg
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Large-CRP OmcB Protein

20-abx600012
  • EUR 2486.00
  • EUR 1455.00
  • EUR 1622.00
  • EUR 1107.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Like Glycosyltransferase (LARGE) Antibody

abx432911-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432912-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Human LARGE shRNA Plasmid

20-abx956100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LARGE shRNA Plasmid

20-abx971279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Like Glycosyltransferase (LARGE)

4-RPH936Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95461
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Like Glycosyltransferase expressed in: E.coli

pSG5 Large T Plasmid

PVT15908 2 ug
EUR 325

LARGE Recombinant Protein (Human)

RP040651 100 ug Ask for price

LARGE Recombinant Protein (Rat)

RP207821 100 ug Ask for price

LARGE Recombinant Protein (Mouse)

RP146864 100 ug Ask for price

Measuring Spoon (Large Pack)

SPN1 200pack
EUR 479
Description: Individually wrapped 1.2mL spoons. Sterile. Pack of 200.

Insulin

RA20056 100 ul
EUR 370

Anti-C1q R1/CD93 Monoclonal Antibody (1A10E10)

CTA-140-100ug 100ug Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (1A10E10) for WB, ELISA, Flow, ICC/IF, IHC, IHC-P.

Anti-C1q R1/CD93 Monoclonal Antibody (1A10E10)

CTA-140-1mg 1mg Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (1A10E10) for WB, ELISA, Flow, ICC/IF, IHC, IHC-P.

Anti-C1q R1/CD93 Monoclonal Antibody (2F7D11)

CTA-231-100ug 100ug Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (2F7D11) for WB, ELISA, IHC.

Anti-C1q R1/CD93 Monoclonal Antibody (2F7D11)

CTA-231-1mg 1mg Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (2F7D11) for WB, ELISA, IHC.

Rabbit Anti-C1q R1/CD93 Polyclonal Antibody

CTA-372-100ug 100ug Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C1q R1/CD93 Polyclonal Antibody

CTA-372-1mg 1mg Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, IHC, IHC-P.

Goat Anti-C1q R1/CD93 Polyclonal Antibody

CTA-373-100ug 100ug Ask for price
Description: Goat anti-C1q R1/CD93 polyclonal antibodyfor WB, Flow, CyTOF-ready, ICC/IF.

Insulin (large) R1: 2×13.5ml