Insulin (large) R1: 2×13.5ml 

To Order Contact us: stephen@expresspharmapulse.com

Ginsenoside R1
TBW01039	ChemNorm	20mg	Ask for price

Zingibroside R1
TBZ2642	ChemNorm	20mg	Ask for price

Notoginsenoside R1
TN02805	ChemNorm	25mg	Ask for price

Stipuleanoside R1
TBZ0899	ChemNorm	unit	Ask for price

Rathbunioside R1
TBZ2265	ChemNorm	unit	Ask for price

Antigen-Antibody Pen For Rabbit Primary antibodies
PEN-R1	Alpha Diagnostics	1	EUR 202

IFNGamma R1/ Rat IFNGamma R1 ELISA Kit
ELA-E0420r	Lifescience Market	96 Tests	EUR 886

Njmu-R1 antibody
22401-100ul	SAB	100ul	EUR 390

TNF R1 antibody
20R-1464	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal TNF R1 antibody

TNF-R1 Antibody
3125-100	Biovision		EUR 354

TNF-R1 Antibody
3125-30T	Biovision		EUR 146

TNF R1 antibody
70R-12323	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal TNF R1 antibody

TNF-R1 Antibody
32304-100ul	SAB	100ul	EUR 252

TNF-R1 Antibody
5348-100	Biovision		EUR 316

TNF-R1 Antibody
5348-30T	Biovision		EUR 146

TNF-R1 Antibody
DF6447	Affbiotech	200ul	EUR 304
Description: TNF-R1 Antibody detects endogenous levels of total TNF-R1.

sigma R1 Antibody
20-abx004198	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gingipain R1 Antibody
20-abx109432	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

sigma R1 siRNA
20-abx904935	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PACAP-R1 Antibody
20-abx225015	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

sigma R1 siRNA
20-abx933365	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

sigma R1 siRNA
20-abx933366	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TNF- R1 Antibody
ABD6447	Lifescience Market	100 ug	EUR 438

TRAIL R1/CD261
GT15061	Neuromics	100 ug	EUR 526

LARGE antibody
70R-6856	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE

LARGE siRNA
20-abx922269	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LARGE siRNA
20-abx922270	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGF beta R1 antibody
20R-1832	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal TGF beta R1 antibody

TNF-R1 Blocking Peptide
3125BP-50	Biovision		EUR 153

IFN alpha R1 Antibody
48307-100ul	SAB	100ul	EUR 333

IFN alpha R1 Antibody
48307-50ul	SAB	50ul	EUR 239

TNF R1 Blocking Peptide
33R-10452	Fitzgerald	50 ug	EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNF R1 antibody, catalog no. 20R-1464

GABAB R1 Polyclonal Antibody
40945-100ul	SAB	100ul	EUR 252

GABAB R1 Polyclonal Antibody
40945-50ul	SAB	50ul	EUR 187

Polyclonal TNF-R1 Antibody
APR00027G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNF-R1 . This antibody is tested and proven to work in the following applications:

Polyclonal TNF-R1 Antibody
APR00285G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNF-R1 . This antibody is tested and proven to work in the following applications:

TNF-R1 Blocking Peptide
DF6447-BP	Affbiotech	1mg	EUR 195

Gingipain R1 Antibody (Biotin)
20-abx106354	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gingipain R1 Antibody (FITC)
20-abx107767	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gingipain R1 Antibody (HRP)
20-abx109184	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TNF-R1 Conjugated Antibody
C32304	SAB	100ul	EUR 397

TNF-R1 Antibody (Biotin)
abx446691-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

TNF-R1 Antibody (FITC)
abx446693-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

TNF-R1 Antibody (HRP)
abx446695-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

GABAB R1 Polyclonal Antibody
ABP54428-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950 Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950

GABAB R1 Polyclonal Antibody
ABP54428-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950 Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950

GABAB R1 Polyclonal Antibody
ABP54428-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950 Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat. This GABAB R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA rangle: 870-950

GABAB R1 Polyclonal Antibody
ABP51390-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920 Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920

GABAB R1 Polyclonal Antibody
ABP51390-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920 Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920

GABAB R1 Polyclonal Antibody
ABP51390-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920 Applications tips:
Description: A polyclonal antibody for detection of GABAB R1 from Human, Mouse, Rat, Monkey. This GABAB R1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GABAB R1 at AA range: 840-920

TNF-R1 Polyclonal Antibody
ABP56405-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430 Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430

TNF-R1 Polyclonal Antibody
ABP56405-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430 Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430

TNF-R1 Polyclonal Antibody
ABP56405-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430 Applications tips:
Description: A polyclonal antibody for detection of TNF-R1 from Human, Mouse, Rat. This TNF-R1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human TNF-R1 at AA range: 350-430

TRH-R1 Polyclonal Antibody
ABP56447-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250 Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250

TRH-R1 Polyclonal Antibody
ABP56447-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250 Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250

TRH-R1 Polyclonal Antibody
ABP56447-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250 Applications tips:
Description: A polyclonal antibody for detection of TRH-R1 from Human, Mouse, Rat, Monkey. This TRH-R1 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human TRH-R1 at AA range: 170-250

TNF-R1 Polyclonal Antibody
ES7404-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TNF-R1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

TNF-R1 Polyclonal Antibody
ES7404-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TNF-R1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA, WB, ELISA

TRH-R1 Polyclonal Antibody
ES7446-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TRH-R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

TRH-R1 Polyclonal Antibody
ES7446-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TRH-R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GABAB R1 Polyclonal Antibody
ES5427-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GABAB R1 Polyclonal Antibody
ES5427-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GABAB R1 Polyclonal Antibody
ES2389-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

GABAB R1 Polyclonal Antibody
ES2389-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GABAB R1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IL-1 R1/CD121a
GT15109	Neuromics	100 ug	EUR 526

Anti-GABAB R1 antibody
STJ93193	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to GABAB R1.

Anti-GABAB R1 antibody
STJ93194	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to GABAB R1.

Anti-TNF-R1 antibody
STJ96052	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to TNF-R1.

Anti-TRH-R1 antibody
STJ96099	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to TRH-R1.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE
EF012373	Lifescience Market	96 Tests	EUR 689

LARGE Blocking Peptide
33R-1247	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Large-CRP OmcBProtein
20-abx600013	Abbexa	EUR 843.00 EUR 439.00 EUR 1274.00 EUR 1636.00 EUR 551.00	100 ug 10 ug 200 ug 500 ug 50 ug
Shipped within 1 month.

Large-CRP OmcBProtein
20-abx600014	Abbexa	EUR 2764.00 EUR 1734.00	100 ug 50 ug
Shipped within 3 months.

LARGE cloning plasmid
CSB-CL012749HU-10ug	Cusabio	10ug	EUR 745
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2271 Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc Show more
Description: A cloning plasmid for the LARGE gene.

LARGE Rabbit pAb
A19515-100ul	Abclonal	100 ul	Ask for price

LARGE Rabbit pAb
A19515-200ul	Abclonal	200 ul	Ask for price

LARGE Rabbit pAb
A19515-20ul	Abclonal	20 ul	Ask for price

LARGE Rabbit pAb
A19515-50ul	Abclonal	50 ul	EUR 308

anti- LARGE antibody
FNab04697	FN Test	100µg	EUR 548.75
Immunogen: like-glycosyltransferase Uniprot ID: O95461 Gene ID: 9215 Research Area: Metabolism
Description: Antibody raised against LARGE

Anti-LARGE antibody
PAab04697	Lifescience Market	100 ug	EUR 386

Anti-LARGE antibody
STJ11100708	St John's Laboratory	50 µl	EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.

Spatulas (Large Pack)
SPAT1	Next Advance	50pack	EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.

GABBR1 antibody (Ser923) (R1-Subunit)
70R-14994	Fitzgerald	100 ul	EUR 392
Description: Rabbit polyclonal GABBR1 antibody (Ser923) (R1-Subunit)

Anti-CD93/C1Q R1 Antibody
A04939	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for CD93 Antibody (CD93) detection. Tested with WB in Human.

Porphyromonas gingivalis Gingipain R1 (rgpA)
1-CSB-MP338957PQP	Cusabio	EUR 293.00 EUR 963.00 EUR 409.00 EUR 717.00	100ug 1MG 200ug 500ug
MW: 58 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in Mammalian cell

Porphyromonas gingivalis Gingipain R1 (rgpA)
1-CSB-EP338957PQP	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 68 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in E.coli

Porphyromonas gingivalis Gingipain R1 (rgpA)
1-CSB-YP338957PQP	Cusabio	EUR 679.00 EUR 335.00 EUR 2172.00 EUR 1051.00 EUR 1442.00 EUR 435.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 56 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Porphyromonas gingivalis Gingipain R1(rgpA),partial expressed in Yeast

Human TRAIL R1 ELISA Kit
EHT0546	Abclonal	96Tests	EUR 521

Human NMDA-R1 ELISA Kit
EHN0034	Abclonal	96Tests	EUR 521

Human STRAIL-R1 ELISA Kit
EHS0303	Abclonal	96Tests	EUR 521

Bovine NMDA-R1 ELISA Kit
EBN0034	Abclonal	96Tests	EUR 521

Bovine STRAIL-R1 ELISA Kit
EBS0303	Abclonal	96Tests	EUR 521

Bovine TRAIL R1 ELISA Kit
EBT0546	Abclonal	96Tests	EUR 521

Anserine NMDA-R1 ELISA Kit
EAN0034	Abclonal	96Tests	EUR 521

Anserine STRAIL-R1 ELISA Kit
EAS0303	Abclonal	96Tests	EUR 521

Anserine TRAIL R1 ELISA Kit
EAT0546	Abclonal	96Tests	EUR 521

Chicken NMDA-R1 ELISA Kit
ECKN0034	Abclonal	96Tests	EUR 521

Canine NMDA-R1 ELISA Kit
ECN0034	Abclonal	96Tests	EUR 521

Canine STRAIL-R1 ELISA Kit
ECS0303	Abclonal	96Tests	EUR 521

Canine TRAIL R1 ELISA Kit
ECT0546	Abclonal	96Tests	EUR 521

Goat NMDA-R1 ELISA Kit
EGTN0034	Abclonal	96Tests	EUR 521

Goat STRAIL-R1 ELISA Kit
EGTS0303	Abclonal	96Tests	EUR 521

Goat TRAIL R1 ELISA Kit
EGTT0546	Abclonal	96Tests	EUR 521

IFN alpha R1 Conjugated Antibody
C48307	SAB	100ul	EUR 397

Porcine NMDA-R1 ELISA Kit
EPN0034	Abclonal	96Tests	EUR 521

Porcine STRAIL-R1 ELISA Kit
EPS0303	Abclonal	96Tests	EUR 521

Porcine TRAIL R1 ELISA Kit
EPT0546	Abclonal	96Tests	EUR 521

Sheep NMDA-R1 ELISA Kit
ESN0034	Abclonal	96Tests	EUR 521

Rat NMDA-R1 ELISA Kit
ERN0034	Abclonal	96Tests	EUR 521

Rat STRAIL-R1 ELISA Kit
ERS0303	Abclonal	96Tests	EUR 521

Rat TRAIL R1 ELISA Kit
ERT0546	Abclonal	96Tests	EUR 521

Rabbit NMDA-R1 ELISA Kit
ERTN0034	Abclonal	96Tests	EUR 521

Rabbit STRAIL-R1 ELISA Kit
ERTS0303	Abclonal	96Tests	EUR 521

Rabbit TRAIL R1 ELISA Kit
ERTT0546	Abclonal	96Tests	EUR 521

Monkey NMDA-R1 ELISA Kit
EMKN0034	Abclonal	96Tests	EUR 521

Mouse NMDA-R1 ELISA Kit
EMN0034	Abclonal	96Tests	EUR 521

Mouse STRAIL-R1 ELISA Kit
EMS0303	Abclonal	96Tests	EUR 521

Mouse TRAIL R1 ELISA Kit
EMT0546	Abclonal	96Tests	EUR 521

Recombinant Human CD200 R1 Protein
RP00837	Abclonal	10 μg	EUR 164

Antibody for Mouse TNF-R1
SPC-170D	Stressmarq	0.1mg	EUR 336
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is unconjugated.

Antibody for Mouse TNF-R1
SPC-170D-A390	Stressmarq	0.1mg	EUR 383
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 390.

Antibody for Mouse TNF-R1
SPC-170D-A488	Stressmarq	0.1mg	EUR 382
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 488.

Antibody for Mouse TNF-R1
SPC-170D-A565	Stressmarq	0.1mg	EUR 382
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 565.

Antibody for Mouse TNF-R1
SPC-170D-A594	Stressmarq	0.1mg	EUR 382
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 594.

Antibody for Mouse TNF-R1
SPC-170D-A633	Stressmarq	0.1mg	EUR 382
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 633.

Antibody for Mouse TNF-R1
SPC-170D-A655	Stressmarq	0.1mg	EUR 382
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 655.

Antibody for Mouse TNF-R1
SPC-170D-A680	Stressmarq	0.1mg	EUR 382
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 680.

Antibody for Mouse TNF-R1
SPC-170D-A700	Stressmarq	0.1mg	EUR 382
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to ATTO 700.

Antibody for Mouse TNF-R1
SPC-170D-ALP	Stressmarq	0.1mg	EUR 376
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Alkaline Phosphatase.

Antibody for Mouse TNF-R1
SPC-170D-APC	Stressmarq	0.1mg	EUR 381
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to APC .

Antibody for Mouse TNF-R1
SPC-170D-APCCY7	Stressmarq	0.1mg	EUR 454
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to APC/Cy7.

Antibody for Mouse TNF-R1
SPC-170D-BI	Stressmarq	0.1mg	EUR 378
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Biotin.

Antibody for Mouse TNF-R1
SPC-170D-DY350	Stressmarq	0.1mg	EUR 397
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 350.

Antibody for Mouse TNF-R1
SPC-170D-DY405	Stressmarq	0.1mg	EUR 385
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 405.

Antibody for Mouse TNF-R1
SPC-170D-DY488	Stressmarq	0.1mg	EUR 375
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 488.

Antibody for Mouse TNF-R1
SPC-170D-DY594	Stressmarq	0.1mg	EUR 377
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 594.

Antibody for Mouse TNF-R1
SPC-170D-DY633	Stressmarq	0.1mg	EUR 372
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Dylight 633.

Antibody for Mouse TNF-R1
SPC-170D-FITC	Stressmarq	0.1mg	EUR 374
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to FITC.

Antibody for Mouse TNF-R1
SPC-170D-HRP	Stressmarq	0.1mg	EUR 370
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to HRP.

Antibody for Mouse TNF-R1
SPC-170D-P594	Stressmarq	0.1mg	EUR 389
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to PE/ATTO 594.

Antibody for Mouse TNF-R1
SPC-170D-PCP	Stressmarq	0.1mg	EUR 381
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to PerCP.

Antibody for Mouse TNF-R1
SPC-170D-RPE	Stressmarq	0.1mg	EUR 379
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to RPE .

Antibody for Mouse TNF-R1
SPC-170D-STR	Stressmarq	0.1mg	EUR 380
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is conjugated to Streptavidin.

Antibody for Mouse TNF-R1
SPC-170S	Stressmarq	0.012mg	EUR 65
The Tumor Necrosis Factor Receptor (TNFR) also known as Cluster of differentiation (CD120) is a protein that belongs to the (TNF)/ (TNFR) superfamily. TNF interacts with two distinct receptors TNFR1 and TNFR2. These receptors share no homology on the Show more
Description: A polyclonal antibody for TNFR1 from Human | Mouse | Rat | Bovine | Monkey | Dog | rabbit. The antibody is produced in rabbit after immunization with Mouse Peptide corresponding to AA 20-43 of the mouse TNF-R1 sequence, identical to rat and human over those residues. The Antibody is tested and validated for WB, IHC, ICC/IF, IP assays with the following recommended dilutions: WB (1:1000), IHC (1:100), ICC/IF (1:100). This TNFR1 antibody is unconjugated.

Anti-Mouse SIGN-R1 antibody
STJ16100766	St John's Laboratory	100 µg	EUR 720

Immortalized Drosophila Embryonic Cells (R1)
T0701	ABM	1x106 cells / 1.0 ml	Ask for price

Anti-NMUR1/Neuromedin U R1 Antibody
A09256	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for NMUR1 Antibody (NMUR1) detection.tested for WB in Human.

Anti-C1q R1/CD93 Polyclonal Antibody
CTA-371-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

Anti-C1q R1/CD93 Polyclonal Antibody
CTA-371-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, ICC/IF, IHC, IHC-P.

SheepAnti-C1q R1/CD93 Polyclonal Antibody
CTA-374-100ug	Creative Biolabs	100ug	Ask for price
Description: Sheep mouse anti-C1q R1/CD93 polyclonal antibodyfor WB.

SheepAnti-C1q R1/CD93 Polyclonal Antibody
CTA-374-1mg	Creative Biolabs	1mg	Ask for price
Description: Sheep mouse anti-C1q R1/CD93 polyclonal antibodyfor WB.

Forkhead Box Protein R1 (FOXR1) Antibody
20-abx007921	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Forkhead Box Protein R1 (FoxR1) Antibody
20-abx215461	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Guinea Pig NMDA-R1 ELISA Kit
EGN0034	Abclonal	96Tests	EUR 521

Guinea Pig STRAIL-R1 ELISA Kit
EGS0303	Abclonal	96Tests	EUR 521

Guinea Pig TRAIL R1 ELISA Kit
EGT0546	Abclonal	96Tests	EUR 521

IFN‑gamma R1/CD119(Fc fusion)
E21-K43	EnoGene	10ug	EUR 343

Forkhead Box Protein R1 (FOXR1) Antibody
abx233212-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Forkhead Box Protein R1 (FOXR1) Antibody
20-abx325833	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-Phospho-GABAB R1 (Ser923) Antibody
P07297	BosterBio	100ul	EUR 398
Description: Rabbit Polyclonal Phospho-GABAB R1 (Ser923) Antibody. Validated in WB and tested in Mouse, Rat.

Recombinant human FGF R1/CD331 Protein
RP01151	Abclonal	10 μg	EUR 155

Recombinant Human C1q R1/CD93 Protein
RP00845	Abclonal	10 μg	EUR 183

Caspase-12 Antibody (Large)
24208-100ul	SAB	100ul	EUR 390

Like Glycosyltransferase (LARGE) Antibody
20-abx124463	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody
20-abx128114	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rubisco Large Chain Antibody
20-abx134717	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody
20-abx159680	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody
20-abx159681	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Chicken LARGE ELISA KIT
ELI-08774c	Lifescience Market	96 Tests	EUR 928

LARGE ELISA KIT|Human
EF010620	Lifescience Market	96 Tests	EUR 689

Like Glycosyltransferase (LARGE) Antibody
abx234697-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Rubisco Antibody (Large Chain)
abx332842-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Large-CRP OmcB Protein
20-abx600002	Abbexa	EUR 1970.00 EUR 3919.00 EUR 2541.00 EUR 1414.00	100 ug 1 mg 500 ug 50 ug
Shipped within 3 months.

Large-CRP OmcB Protein
20-abx600012	Abbexa	EUR 2486.00 EUR 1455.00 EUR 1622.00 EUR 1107.00	1 mg 200 ug 500 ug 50 ug
Shipped within 3 months.

Like Glycosyltransferase (LARGE) Antibody
abx432911-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody
abx432912-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Human LARGE shRNA Plasmid
20-abx956100	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LARGE shRNA Plasmid
20-abx971279	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Like Glycosyltransferase (LARGE)
4-RPH936Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O95461 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 47.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Like Glycosyltransferase expressed in: E.coli

pSG5 Large T Plasmid
PVT15908	Lifescience Market	2 ug	EUR 325

LARGE Recombinant Protein (Human)
RP040651	ABM	100 ug	Ask for price

LARGE Recombinant Protein (Rat)
RP207821	ABM	100 ug	Ask for price

LARGE Recombinant Protein (Mouse)
RP146864	ABM	100 ug	Ask for price

Measuring Spoon (Large Pack)
SPN1	Next Advance	200pack	EUR 479
Description: Individually wrapped 1.2mL spoons. Sterile. Pack of 200.

Insulin
RA20056	Neuromics	100 ul	EUR 370

Anti-C1q R1/CD93 Monoclonal Antibody (1A10E10)
CTA-140-100ug	Creative Biolabs	100ug	Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (1A10E10) for WB, ELISA, Flow, ICC/IF, IHC, IHC-P.

Anti-C1q R1/CD93 Monoclonal Antibody (1A10E10)
CTA-140-1mg	Creative Biolabs	1mg	Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (1A10E10) for WB, ELISA, Flow, ICC/IF, IHC, IHC-P.

Anti-C1q R1/CD93 Monoclonal Antibody (2F7D11)
CTA-231-100ug	Creative Biolabs	100ug	Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (2F7D11) for WB, ELISA, IHC.

Anti-C1q R1/CD93 Monoclonal Antibody (2F7D11)
CTA-231-1mg	Creative Biolabs	1mg	Ask for price
Description: Mouse anti-C1q R1/CD93 monoclonal antibody (2F7D11) for WB, ELISA, IHC.

Rabbit Anti-C1q R1/CD93 Polyclonal Antibody
CTA-372-100ug	Creative Biolabs	100ug	Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, IHC, IHC-P.

Rabbit Anti-C1q R1/CD93 Polyclonal Antibody
CTA-372-1mg	Creative Biolabs	1mg	Ask for price
Description: Rabbit anti-C1q R1/CD93 polyclonal antibodyfor WB, IHC, IHC-P.

Goat Anti-C1q R1/CD93 Polyclonal Antibody
CTA-373-100ug	Creative Biolabs	100ug	Ask for price
Description: Goat anti-C1q R1/CD93 polyclonal antibodyfor WB, Flow, CyTOF-ready, ICC/IF.

Insulin (large) R1: 2×13.5ml